1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iris [78.8K]
3 years ago
15

When policymakers are considering a particular action, they can use consumer surplus as a(n) A. objective measure of the benefit

s to buyers as determined by policymakers. B. measure of the benefits to buyers as the buyers perceive them. C. potentially flawed measure of the benefits to buyers if the buyers are not rational. D. Both b) and c) are correct.
Law
1 answer:
kramer3 years ago
6 0

Answer:

D. Both b) and c) are correct.

Explanation:

Consumer surplus is the difference between the total profit we get from service and its market price. This means that the first unit to acquire we value it highly but as we acquire additional units our valuation falls. However, the price we pay for any unit is always the same.

Thanks for your question!

You might be interested in
Who has to confirm (approve) of presidential appointments to the Cabinet and Supreme Court?
Gnesinka [82]

Answer:

From its earliest years, the Senate has jealously guarded its power to review and approve or reject presidential appointees to executive and judicial branch posts. In its history, the Senate has confirmed 126 Supreme Court nominations and well over 500 Cabinet nominations.

Explanation:

Hope this helps you! :)

6 0
3 years ago
What pathway do root cells use to obtain energy and identify the organelles involved
Lera25 [3.4K]
This is a biology question
3 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
2 years ago
Which of the following was NOT a part of the Mayflower Compact?
VMariaS [17]

<h3>OC. The colonists would help further the one society they create</h3>

5 0
2 years ago
Raina is ready to start taking photographs at a crime scene after she secured the crime scene. Which photos should she take firs
Reil [10]
C or d. I’m not sure which one sorry
4 0
3 years ago
Other questions:
  • Heyy, Howzit going??
    13·2 answers
  • Provide an example of a scenario where someone who has been victimized maybe more likely to be treated as a Perpetrator Dan supp
    15·1 answer
  • How many road signs questions are on the DMV California permit test?
    9·1 answer
  • Which of the following are formal classifications to serve to serve in the Senate? Select all that apply.
    5·2 answers
  • A lawyer contacted by telephone a nationally-recognized malpractice defense attorney after being sued by a client for negligentl
    7·1 answer
  • When a company goes public, it begins doing what?
    13·1 answer
  • Brainly needs to fix the tutorial... why you got to pay for it now​
    7·1 answer
  • Saudfaisal451 ....is my best friend​
    6·2 answers
  • One example of ________ is the fact that a lawsuit filed by Washington against Nevada over river pollution goes directly before
    9·1 answer
  • What does the judge do when link deas speaks up in support of tom?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!