Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
both are chemical reactions
hope this helps :)
Nitrogen is present in the environment in abundance but still we cant inhale nitrogen
<h3>
What is the role of nitrogen in our body?</h3>
Nitrogen is physiologically inert. It contributes nothing to the functioning of our bodies. The cells in our body need oxygen to live, not nitrogen. we can find nitrogen in our body in form of nitrogeneous base in nucleotide.
We inhale all gases present in air fills our alveoli, by the process of diffusion, only oxygen in the air is taken into the blood stream while the other gases along with the waste CO2 is exhaled. So you do breathe in nitrogen, but it is exhaled as it is by the body.
Learn more about nitrogen here:
brainly.com/question/9176500
#SPJ4
Answer:
Explanation:
The VHL gene is a tumour suppressor gene that regulates cell growth and cell death. This gene is also located on chromosome 3. It functions to prevent rapid proliferation of cells. For a person to develop tumor both copies of the gene must be mistake or altered allowing for a loss of function that prevents its from causing degradation of HIF1α in the normal oxygen level as its it normal function. This then allows for the survival of HIF1α that promotes amgiogenesis promoting tumor development.
Meningitis , it is the inflammation of the meninges
