1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
r-ruslan [8.4K]
3 years ago
10

7. Around what latitude would you guess would have the biggest temperature change

Biology
1 answer:
e-lub [12.9K]3 years ago
3 0

Answer:

Latitude is distance between earth and equator. The temperature decrease by  degree for every 100 meters latitude.

Explanation:

Latitude is the distance between earth and equator. The lower the latitude there will be higher temperature. When latitude increase the temperature began to fall. The equator is the potion of earth where sun rays directly strike which makes feel hotter. The temperature gets cooler when it approaches the poles. There can be slight variations in the climate throughout the year. The places away from latitude are colder and receives less sunlight.

You might be interested in
Which is the correct order in the scientific process?
s2008m [1.1K]
Make an observation, form a question, form a hypothesis.
7 0
2 years ago
Should Cetaceans be considered mammals or fish? and why
Liula [17]

Answer:

Mammal

Explanation:

A mammal is any any animal that is warm-blooded, gets milk from its mother, and is born alive, etc. Therefore a Cetacean should be considered a mammal.

Hope this helps!

8 0
3 years ago
Please help it’s timed
Keith_Richards [23]
The answer is true because walking does not affect the environment
3 0
3 years ago
Any animal eaten by a predator could be classified as:
Alenkinab [10]
I think that the answer is A.) prey
6 0
3 years ago
Approximately what percent of these products are recycled? aluminum: % steel: % copper: %
padilas [110]

The percentage of these products which are recycled include the following:

  • 50% Aluminum
  • 25 % steel
  • 60% copper.

<h3>What is Recycling?</h3>

This is defined as the process in which different types of waste are converted into usable materials through different processes and techniques.

Recycling is important as it helps to reduce incidences of pollution and wastage thereby improving the quality of living for humans and other organisms present on Earth. The percentage of aluminum, steel and copper products being recycled can be seen above.

Read more about Recycling here brainly.com/question/2055088

#SPJ1

5 0
1 year ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • How is a graph similar to a data table
    14·1 answer
  • Explain the importance of decomposrs to the overall biogechemical cycle
    11·1 answer
  • Having the same number of protons and electrons results in a positively charged atom.
    15·2 answers
  • Suppose you observed 32 whitefish blastula cells. One cell was in metaphase, 3 were in anaphase, 8 were in prophase, and 4 were
    11·1 answer
  • How does a seahorse reproduce
    6·2 answers
  • Which describes the double-loop system but not the single-loop system?
    13·2 answers
  • 1. In what ways are Fungi similar to Bacteria? Different? How do they obtain energy? (pg. 109)
    10·1 answer
  • How many weeds are on the noxious weed list?
    12·1 answer
  • 1) Panspermia is a hypothesis that states that life on Earth may have been purposefully or accidentally seeded by life from othe
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!