1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natali5045456 [20]
3 years ago
5

Bees use nectar from the flowers of plants as food. As they collect nectar, dustlike pollen grains stick to their body. When the

y move from flower to flower, pollen is transferred to other flowers. The pollen from other flowers helps the plant make seeds.
Which challenge of life does the plant help the bee meet?













A.
acquiring energy







B.
reproduction








C.
maintaining its structure







D.
homeostasis
Biology
1 answer:
goldenfox [79]3 years ago
8 0
I think that its A. acquiring energy

I hope this helps ^-^
(let me know if im wrong)
You might be interested in
a scientist heated 10 grams of mercuric oxide and formed 9.3 grams of liquid mercury how many grams of oxygen were formed
Verdich [7]
<span>Mercury oxide --- &gt; liquid mercury plus oxygen.

If 10 grams of mercuric oxide were being heated, and 9.3 gram of liquid mercury is being produced. To find the grams of oxygen produced is, you take the mass of mercuric oxide minus the mass of liquid mercury which is 10 grams - 9.3 grams = 0.7 grams.

The answer is 0.7 grams.
</span>
6 0
3 years ago
Read 2 more answers
Which condition in the ocean is most responsible for an increase of fish at the surface?
Naily [24]

Answer:

upwelling

Explanation:

3 0
3 years ago
How can nanotechnology be used to treat cancer patients?
qwelly [4]
 Nanotechnology offers the means to target chemotherapies directly and selectively to cancerous cells and neoplasms, guide in surgical resection of tumors, and enhance the therapeutic efficacy of radiation-based and other current treatment modalities. 
8 0
3 years ago
I need help. Im pretty sure the answers are B, A, C, C but im not sure. Can someone help me? Questions are in the picture!!
Rzqust [24]

Answer: It is B, A, C and C

Explanation:

You were correct

3 0
3 years ago
Read 2 more answers
A boy is standing next to a radio. As he moves away from the radio, which would MOST LIKELY occur?
Art [367]
It should be c, because the farther away from a radio, the lower the sound would be
6 0
4 years ago
Read 2 more answers
Other questions:
  • Choose all the answers that apply. The rough endoplasmic reticulum _____. contains ribosomes is responsible for protein synthesi
    7·2 answers
  • Why does table salt (NaCl) dissolve readily in water?
    6·2 answers
  • Redi's experiments were accepted by all as proof of the theory of biogenesis.
    13·1 answer
  • What is the most important reason to control the conditions ofan experiment
    5·2 answers
  • What happens to DNA before a cell divides
    5·1 answer
  • Which image is a correctly labeled prokaryotic cell?
    14·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • How would a small, uncharged lipid move across the cell membrane?
    15·1 answer
  • Hii! i’ll give brainliest pls help
    9·2 answers
  • A plant releases 24 molecules of carbon dioxide.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!