1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kaylis [27]
3 years ago
11

A functional assessment of the spinal nerves that form the lumbar plexus indicated a functional loss of spinal nerve L2 on the r

ight side. How would this affect the nerves listed Ilionguinal nerve, genitofemoral nerve, lateral femoral cutaneous nerve, and the femoral nerve? Would each nerve be equally affected? Explain Answer?

Biology
1 answer:
Helga [31]3 years ago
8 0

Answer:

Please see attachment

Explanation:

Please see attachment

You might be interested in
Skin is the largest organ of our body.
murzikaleks [220]

Answer:

false

Explanation:

skin is not an organ

4 0
3 years ago
Read 2 more answers
The skin of an animal should be examined for
Serga [27]
The skin of the animal<span> is one of the first systems affected so it is the first indicator when an </span>animal becomes sick. The skin of an animal should be examined for signs of disease. Examined should be the structure and the <span>functioning of the skin. If there are some abnormalities it can be sign that the animal is sick. </span>
7 0
3 years ago
The inner membrane of the mitochondrion is folded into cristae. The cristae _____ the surface area of the inner membrane, _____
Jet001 [13]

Answer:

The inner membrane of the mitochondrion is folded into cristae. The cristae

<u>increase</u> the surface area of the inner membrane, <u>enhancing</u> the mitochondrion's ability to produce ATP through <u>cell respiration</u>.

Explanation:

Options for this question are

  • <em>increase - inhibiting - photosynthesis</em>
  • <em>decrease - enhancing - cell respiration</em>
  • <em>increase - enhancing - cell respiration</em>
  • <em>decrease - inhibiting - photosynthesis</em>

Mitochondria are the organelles in charge of energy production inside the cell. For the mitochondrion to achieve its goal, a series of metabolic processes must occur, that require the presence of oxygen and organic substrates.

Mitochondrial cristae are the configuration of the mitochondrial internal membrane, with the purpose of increasing the surface where metabolic reactions and the electron transfer chain occur, in order to obtain ATP molecules, during the process of oxidative phosphorylation, also called cellular respiration.

Learn more:

Mitochondrion brainly.com/question/1128811

8 0
3 years ago
What occurs when a pure gaseous substance is heated?<br> Please answer fast!
Gwar [14]

Answer:

its molecules start moving at a much faster speed and this consequently causes an increase in pressure within the container holding the gas. If the container is not strong enough, the activity of the gas molecules is likely to cause it to burst

hope this helps

Explanation:

8 0
3 years ago
Mary has 600 grams of blueberries, 450 grams of strawberries, and 525 grams of blackberries. What is the total weight of the fru
NISA [10]

Answer:

525

Explanation:

f 1/5 of the remaining blueberries are used to make ...

Missing: 525 ‎| Must include: 525

7 0
3 years ago
Read 2 more answers
Other questions:
  • Cory is explain the principle of superposition to his friend which of the following is the best explanation Corey could give
    7·1 answer
  • Chain of hemoglobin is 1 m.u. from the albino locus. assume for the moment that the same is true in humans. the disease sickle-c
    7·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • Which of the following processes returns carbon to the atmosphere?
    7·1 answer
  • Which RNA is<br> found inside the nucleus?​
    11·2 answers
  • The number of daughter cells produced by meiosisis.
    15·1 answer
  • Which of the following is NOT found in tRNA?
    6·1 answer
  • Fill in the Blank
    13·1 answer
  • What can DNA be compared to?
    12·2 answers
  • __________________________ is a hybrid of pure and applied science. academic research technoscience industrial research biotechn
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!