1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kaheart [24]
3 years ago
13

What is the meaning of prey

Biology
2 answers:
kondaur [170]3 years ago
4 0

Answer: an animal that is hunted and killed by another for food.

Explanation:

stiks02 [169]3 years ago
3 0

Answer:

an animal hunted or ceased for food

Explanation:

Google is a very powerful tool, use it

You might be interested in
Describe the water vascular system
Leno4ka [110]
<span> It is a hydraulic </span>system<span> used by echinoderms, such as sea stars and sea urchins, for locomotion, food and waste transportation, and respiration. The </span>system<span> is composed of canals connecting numerous tube feet.</span>
7 0
3 years ago
What happens when the body releases perspiration?
Alex777 [14]

Answer:

D is the answer

8 0
3 years ago
Read 2 more answers
If the central nervous system is the main control center for the body, the peripheral nervous system is the ____________.
KiRa [710]
The answer is A the central nervous system sends a message to the brain and then peripheral nervous system sends out the message to react. I think hope I helped
5 0
3 years ago
Read 2 more answers
Soda and other carbonated beverages seem more "fizzy" when they are served on an airplane at standard cruising altitude. Write a
Katyanochek1 [597]
Answer: the low air pressure reducing CO2 solubility

The differences between the airplane and standard cruising altitude are air pressure. When you are on the higher ground, the air pressure should be lower since there is less air above your head.
In a place with less air pressure, the gas solubility will decrease. Bubbles appeared if gas solubility is lower than the gas concentration. Assuming the beverage concentration is same, then it will be much more bubble appeared in an airplane because the gas solubility is lower.
3 0
3 years ago
Read 2 more answers
Coral reefs only form in ocean waters between 30 N and 30 S. The reefs are confined to shallow water because?
Viktor [21]
Reef-building corals were confined to relatively shallow depths because many of these corals have microscopic algae called zooxanthellae living inside their soft tissues.
 These algae are often important for the corals’ nutrition and growth, but require sunlight for photosynthesis. There is no sunlight deep in the water. 
8 0
3 years ago
Other questions:
  • Introducing additional organisms of the same existing kinds will not upset the ecosystem.
    10·2 answers
  • One of the major advances in brain function in middle childhood is the development of:
    6·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which is best characterized as a "wear-and-tear" disease?
    12·1 answer
  • Which is a function of nephrons? they release urine from the body. they filter perspiration from sweat glands. they release adh
    9·2 answers
  • List two real landforms crated when tectonic plates calide
    5·1 answer
  • PLSSSS HELPPPPPP ME WITH THIS QUESTION
    8·1 answer
  • Which of the following is true about photosynthesis?
    13·1 answer
  • In 2003, the human genome was successfully mapped. This gave researchers more information about the genes that are found in the
    5·2 answers
  • Heart and kidneys are called organs,why?​
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!