1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inysia [295]
3 years ago
15

_______ may have formed the oxygen released into the early atmosphere.

Biology
1 answer:
MissTica3 years ago
3 0
Cyanobacteria or simply known as blue-green algae may have formed the oxygen into the early atmosphere. This is because these micro-organism has the capability to photosynthesize wherein they can produce oxygen and carbohydrates. In fact, all the plants contribute in the fomation of oxygen.
You might be interested in
The jet stream is influenced by what?
Nutka1998 [239]
Hello!

Jet streams are large currents of air that travel around the planet. The ocean does not control the wind. The Sun does not control the wind. Hurricanes do not either. Mountain breezes can influence and are influenced by the jet stream.

I hope this helps!
3 0
3 years ago
Reproduction 1. differentiate asexual and sexual reproduction and give an example of each. reproduction 1. differentiate asexual
Mariana [72]
Asexual reproduction involves only one parent and the offspring is identical to the parent. An example of an organism that reproduces asexually is Archaea or bacteria. Sexual reproduction involves two parents and the offspring's genes are equally contributed by each parent. An example of organisms that reproduce sexually are some land mammals. The chromosomes of a parent and offspring in asexual reproduction are identical and there is no difference in the chromosomes. 
7 0
3 years ago
The living organism found within an ecosystem
Murljashka [212]

Answer:

The living organisms in an ecosystem can be divided into three categories: producers, consumers and decomposers. They are all important parts of an ecosystem. Producers are the green plants The third type of living organism in an ecosystem is the decomposers.

Explanation:

no

8 0
2 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Which statement describes why the devshirme system was so important to
KiRa [710]
The correct answer is B
5 0
3 years ago
Other questions:
  • One way in which wetlands control flooding is by a. filtering out water pollutants. b. absorbing water from rivers. c. providing
    6·1 answer
  • Which traits are likely to be different alleles of the same gene? Check all that apply.
    10·2 answers
  • Long, saturated fatty acid tails ____________ lipid mobility and ____________ membrane fluidity.
    11·1 answer
  • Constructing phylogenies is not as simple as grouping organisms with similar characters together. Identify situations in which s
    14·1 answer
  • From a population of red brown orange yellow and green butterflies only the red and green ones survive since they can blend into
    12·1 answer
  • Why do muscle cells have more mitochondria than bone cells
    13·1 answer
  • Saguaro cacti, elf owls, horned lizards, and fire ants all share the same area of a desert. Which of the following groups is a p
    10·1 answer
  • The image shows Isotherms on a map.
    6·2 answers
  • Which of the following is NOT one of the classifications of tissue?
    13·1 answer
  • Which element is the least reactive?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!