In my opinion, the correct answer among the choices listed is option C. The members of the kingdom Protista are least similar to a bacteria. Protists are eukaryotic organisms which cannot be classified as a fungus, animal, or a plant. They are mostly unicellular organisms.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
If the sun was farther away from Earth
Explanation:
Answer: A, the sun creates it's own light.
Explanation: <em>The moon can't create it's own light, so the sun shines on the moon and it </em><em>reflects</em><em>, or "bounces" off. The sun is able to produce it's light by </em><em>fusion,</em><em> which also creates heat. </em>
<em />
