1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kondaur [170]
3 years ago
15

Does the embryo have any leaves? If so, how many? If the embryo has 12 chromosomes, how many chromosomes does a bean or corn spe

rm cell have? How many chromosomes does a bean or corn egg cell have?
Biology
1 answer:
iris [78.8K]3 years ago
5 0
<h2>Answer :</h2><h3>Part 1:</h3>

Yes, embryos have leaves which are known as cotyledons.

Plants with two embryonic leaves are termed dicotyledonous ("dicots") .

Plants with one leave are known as monocotyledon.

<h3>Part 2:</h3>

Six (6) Chromosomes.

As embryo is formed from the combination of egg and sperm. If embryo has 12 chromosomes then sperm will have half means 6 chromosomes.

<h3>Part 3:</h3>

Six (6) Chromosomes.

As embryo is formed from the combination of egg and sperm. If embryo has 12 chromosomes then egg of a bean or corn will have half means 6 chromosomes.


You might be interested in
When materials are moving across a membrane
kolezko [41]
This ain’t even a question
7 0
3 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Steady slate what the human body strives to maintain
mestny [16]
The human body strives to maintain homeostasis, the state of balance between internal and external change.
4 0
4 years ago
Complete the sentence to explain how organisms develop in a changing environment.
enot [183]

Answer:

<u><em>Genetic variation</em></u> occurs because beneficial traits exist in a collection of genes, and <u><em>gene flow</em></u> makes these traits more prevalent in populations.

Explanation:

In biology, genetic variation can be described as the different genotypes which occur in species of the same kind. This genetic variation allows those organisms to survive on Earth which are better adapted to survive to the environmental changes.

The organisms which are better adapted to live in an environment will reproduce and pass their traits to the offsprings. Over time, these traits will become more prevalent in a population.

4 0
4 years ago
Read 2 more answers
Why are some secondary consumers carnivores,while others are omnivores
ivanzaharov [21]
Some other secondary consumers are carnivores and others are omnivores because they also eat both plants and meat. For example Human, human are secondary consumers, and human eat both plants and meat. There are also other animals that are considered as omnivores.
3 0
3 years ago
Other questions:
  • Dont answer if you dont know
    14·1 answer
  • Please help me it would mean a lot!
    15·1 answer
  • Until recently, Henry has been very healthy. Alas, Henry recently was prescribed a medicine for a blood clot in his leg, which l
    13·1 answer
  • The zika virus was first identified in Uganda in 1947. The virus is transmitted from person to person by a bite from a mosquito.
    15·1 answer
  • Question 16
    7·1 answer
  • Celluar respiration formula
    6·1 answer
  • Pacemakers maintain the heartbeat in people who suffer from certain defects. The function of an artificial pacemaker is to send
    11·2 answers
  • Sporopollenin, found in the _____, protects the pollen grain against UV radiation, dehydration, and pathogen attack.
    8·1 answer
  • The accumulation of glucose 6-phosphate inside a bacterial cell via phosphorylation of glucose is an example of:
    9·1 answer
  • Rock that erodes to expose layering is _____
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!