Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
The possible genotypes for someone who can roll their tongue are RR or rr, where the R allele is dominant over the r allele.
<h3>What do you mean by Genotypes?</h3>
Genotypes may be defined as the ultimate combination of alleles of those genes which are selected for a particular study or interest.
If R represents the dominant allele and a person rolls their tongue having this allele, while the r represents the recessive allele and a person can not roll their tongue having this allele. To roll their tongue, a person needs only one dominant allele. Thus the person could have genotypes of RR or Rr.
Therefore, the possible genotypes for someone who can roll their tongue are RR or rr, where the R allele is dominant over the r allele.
To learn more about Mendelian Genetics, refer to the link:
brainly.com/question/2240360
I believe that is the nucleus, if so the answer is D) Genetic Information. The nucleus carries chromosomes that are composed of DNA that carry genetic information.
Hair, Skin color, Eye color
Let H= No Hemophilia
h= Hemophilia
Now we will create the genotypes for the parents, it says that the mother is heterozygous which means she will carry the dominant and recessive allele, which would be Hh and it says the father is normal which would mean that he would be No Hemophilia dominant, so it would be HH
Cross the 2 created genotypes: Hh x HH
Now create your Punnett square using the 2 created genotypes above
H h
H HH Hh
H HH Hh
Looking at the Punnett square above, it appears that there’s a 2:2 ratio or a 50% chance of having Hemophilia and not having Hemophilia
So for a female child: 1/2 x 1/2= 1/4 of having a female with Hemophilia
The first one represents the female child having Hemophilia or not, that one can be obtained by simplifying the 2:2 ratio to a 1:1 ratio and the other one represents the chances of their child being a female. I assume that the steps above would be repeated again for the male child.
I hope that helps!
