How does the formation of oil differ from the formation of coal

1 answer:

8 0

The formation oil, that is, sweet crude, is typically that accumulate on the seafloor and "kitchen" of the geothermal gradient to be altered in petroleum products.while Most of the coal we use now was formed about 300 million years ago, when much of the earth was covered by steamy swamps.

hope that helped

You might be interested in

A mixture of the amino acids leucine, glutamate, and arginine, is added to a cation exchange column at neutral ph. in what order

natulia [17]

Cation-exchange chromatography is used when the molecule of interest is positively charged, the stationary phase is negatively charged and positively charged molecules are loaded to be attracted to it. So, the amino acids with negative charge will elute the first. Glutamate, leucin, arginine is the order of elution because of their pI values ~3, ~6 ~10.

5 0

2 years ago

This adult organism can be described as a Select all answers that apply. A. invertebrate. B. vertebrate. C. chordate. D. nematod

melamori03 [73]

I think it's B or D

5 0

3 years ago

Read 2 more answers

You have batch of pea plants with purple flowers that you grew by crossing plants that had purple flowers (PP) with plants that

nordsb [41]

If I have a batch of pea plants with purple flowers that I grew by crossing plants that had purple flowers (PP) with plants that had white flowers (pp), purple flowers (dominant) will be expressed in this batch of pea plants.

3 0

3 years ago

PLS HELP ME WITH THIS!!! What is the nucleotide sequence of the mRNA strand you built?

Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0

2 years ago

Read 2 more answers

Which is the order of airflow during inhalation?

tigry1 [53]

Answer:

Nasal cavity, larynx, trachea, bronchi, bronchioles, alveoli.

Explanation:

The air travels through the respiratory system during inhalation in the next order:

Nasal cavity: You inhale air into your nose.
Larynx: The air travels down to this organ, a hollow, tubular structure that plays a key role in phonation, respiration, and deglutition.
Trachea: (Or windpipe) is a wide, hollow and cartilaginous tube that connects the larynx to the bronchi.
Bronchi: The trachea divides into two primary bronchi; they are the main passageway into the lungs.
Bronchioles: The bronchi develop smaller the closer they get to the lung tissue and are then consider bronchioles.
Alveoli: They are tiny air sacs located at the end of the bronchioles, which is the site of oxygen and carbon dioxide exchange in the respiratory system.

8 0

2 years ago