1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ghella [55]
3 years ago
15

Why would mitochondria in heart muscle cells have more cristae than mitochondria in skin cells?

Biology
1 answer:
anyanavicka [17]3 years ago
5 0

Answer:

The structure of mitochondria contains the foldings in the inner side called "cristae" which increase the surface area of the mitochondria. The cristae are important to mitochondria as well as cell as cristae embody the ATP synthase enzymes which help in the formation of the ATP molecules.

Heart cells require more energy to pump the blood from the heart to the body so it needs a more mitochondrial number in the cells with more infoldings to synthesize more ATP.

You might be interested in
What is the best source of nuclear DNA when working with hair samples?
tino4ka555 [31]
The answer is a hair root.

Nuclear DNA is commonly extracted from the hair root. The hair root consists of keratinocytes. Keratinocytes are cells found in the epidermis. As all other cells, they contain DNA material. When keratynocites die, they get converted into keratoid material in the process of cornification. As a consequence, d<span>ead cells do not contain DNA material. Therefore, the hair root is the best source of nuclear DNA than shed or cut hair when working with hair sample.</span>
4 0
3 years ago
Read 2 more answers
What can be predicted for a child who received a dominant allele for "tallness" from one parent and a recessive allele for "shor
DerKrebs [107]
The child would possibly still be considered as tall because the tall genes is Dominant, and the only way that recessive allele is selected is when the child receives two recessive allele
3 0
3 years ago
Using the graphs below, which group of moths is better adapted to survive the hunting cycle?
Mrac [35]

Answer:

Using the graphs below, which group of moths is better adapted to survive the hunting cycle?

Light moths on light trees

Explanation:

3 0
2 years ago
Read 2 more answers
How are rogue waves and tsunamis alike and different?
GrogVix [38]

Answer:

Your username looks like you headbutted the keyboard and unfortunately, I doubt anyone is going to write three paragraphs for you.

Explanation:

Start here:

https://science.howstuffworks.com/environmental/earth/oceanography/rogue-wave4.htm

5 0
2 years ago
What does a dominant trait and recessive trait mean (if you cheat you dont get the brainliest)
Andrew [12]

Answer:

A dominant trait is a trait that overpowers, a recessive trait is more rare.

Explanation:

Dominant traits are the most common trait in a pair. They will be seen the most often in offspring. Recessive traits are usually repressed traits that the parents had that were not previously visible

5 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Marcus discovered that sodium (Na) is found in Group 1, Period 3 on the periodic table. Where should Marcus look to find another
    5·1 answer
  • If a molecule is too large to slip through the spaces in the membrane, how will that molecule enter the cell?
    7·1 answer
  • What do we call an individual that has one dominant and one recessive allele for a trait?
    12·1 answer
  • How are models used
    8·2 answers
  • Natural selection increases the frequency of beneficial alleles in
    15·1 answer
  • This is for Fossil Fuels.
    9·1 answer
  • A control group is a group that:
    6·1 answer
  • The most common blood type in the United States is _________. What blood type is safe for a person with this blood type to recei
    14·1 answer
  • Hemophilia is a recessive s**-linked disorder located on the X chromosome where a person's body can not control blood cl*tting o
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!