1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
allsm [11]
3 years ago
6

The virus begins the replication cycle, and hijacks the cellular machinery to make new viruses

Biology
1 answer:
umka21 [38]3 years ago
8 0

the virus on beginning the replication cycle, hijacks the host cell and its cellular machinery to make new virus by producing the new replicated viral genome.

Explanation:

The life cycle of virus begins with the replication cycle. The virus gets in alive by acquiring a new host cell or say hijacking the new cell and its cellular machinery. The cellular machinery is then forced in order to perform for the virus itself, and it does so by replicating the viral genome.

The replicated viral genome then makes viral protein which produces new capsids of viruses. These viral particles are then rearranged to form a new virus altogether.

You might be interested in
Define tissue and explain where it falls in the hierarchy of structural organization
Aliun [14]
<span>The tissue is a group of structurally and functionally similar cells and their extracellular matrix. Grouping of those similar cells enables them to carry out a specific function. In the hierarchy of structural organisation tissue is level between cells and a complete organ. Functional grouping together of multiple tissues forms an organ.</span>
6 0
4 years ago
Which of the following statements is not true of antibody staining? Which of the following statements is not true of antibod
Free_Kalibri [48]

Answer:

The statement that is not true for antibody staining is it can provide information about gene expression.

Explanation:

Antibody staining is important aspect of applied immunology. Antibody staining is done to determine a specific protein in a given sample.Antibody staining is done by using fluorescent dyes and also by using specific enzyme such as horse reddish peroxidase,alkaline phosphatase.

         Antibody staining can be visualized with either fluorescent or radioactive labels. Antibody staining can be performed by western blotting method.Multiple antibodies can be used to stain different proteins.Antibody staining requires the hybridization of the complementary base sequence of the antibody and also the target protein to which it binds.

5 0
3 years ago
The life process of reproduction refers to what
Lerok [7]

Answer:

the formation of new cells for the replacement and repair of old cells as well as for growth.

Explanation:

5 0
3 years ago
How can molecular evidence show species relatedness
ohaa [14]
Molecular evidence would include DNA
by comparing Gene sequence, you can tell which species have the most genes in common
6 0
3 years ago
Read 2 more answers
Which of the following states of matter has a definite shape?
weeeeeb [17]
Solid Liquid Gas or Plasma , a define shape would have to be the solid
3 0
3 years ago
Read 2 more answers
Other questions:
  • Discuss two ways that all cells are alike
    6·2 answers
  • Most biopolymers industrially produced by means of microorganisms are
    10·1 answer
  • Where a new planet might be found within our solar system
    5·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Raising more sustainable fish would require choosing fish species such as____?
    9·2 answers
  • The grizzly bear feeds on salmon that migrate upriver from the ocean during the spawning season. These fish are rich in carbon,
    9·2 answers
  • How was Cell Theory created?”
    10·1 answer
  • 3 ejemplos de autopoiesis
    7·1 answer
  • Which technique is used for separation of Grain and Husk.​
    6·2 answers
  • The ________ are lymphoid nodules located in the tissue at the base of the tongue in the rear of the mouth
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!