1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nat2105 [25]
3 years ago
12

What is zero population growth?

Biology
2 answers:
levacccp [35]3 years ago
8 0
I would guess it just means that the population just stays the same, no growth.
kotykmax [81]3 years ago
7 0
Ok this will be your answer. The maintenance of a population at a constant level by limiting the number of live births to only what is needed to replace the existing population.
You might be interested in
Write the formula used to calculate the area of a regular object​
AleksAgata [21]

Answer:

Find the area of a square or rectangle by multiplying the length times the width. This formula looks like l*w. If the length is 5 and the width is 2, the area is 10 square units.

Explanation:

5 0
3 years ago
Read 2 more answers
A lipid has three long chains of fatty acids and
schepotkina [342]
A lipid that has 3 long chains of fatty acids covalently attached or bonded to the glycerol backbone would form a single triglyceride molecule.
8 0
3 years ago
Read 2 more answers
The mouth of the shark is part of which organ system?
crimeas [40]

Answer:

Oral cavity

Explanation:

its first organ from which food enter

8 0
2 years ago
What is the weight of the air that is pressing down on us at sea level, in pounds per square inch?
horrorfan [7]

Answer:it hard

j

Explanation:

kjukyjg

8 0
2 years ago
Which sequence is complementary with the sequence attggcta
almond37 [142]
The complementary strand is

taaccgat

T -A
G-C
Always!
5 0
3 years ago
Other questions:
  • Leonard designed a parallel circuit to light two lightbulbs. But his circuit doesn’t work. Which two items in the circuit must b
    12·1 answer
  • The Krebs cycle and electron transport take place in which part of the cell?
    11·1 answer
  • MATch the stages of interphase which what occurs in each stage
    13·1 answer
  • Choose all the answers that apply.
    14·2 answers
  • Which of the following energy sources would most likely be used by a food producer who wants to follow the spirit of the farm to
    13·2 answers
  • Examine the diagram of the cell cycle. Which label identifies the step labeled W? Anaphase:
    14·2 answers
  • You have a batch of tomato plants with hairy stems that you grew by crossing plants that had hairy stems (HH) with plants that h
    13·2 answers
  • Please answer urgently​
    13·1 answer
  • 3) identify and describe three abiotic characteristics of ecosystems. Give an example of how each
    9·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!