1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
klasskru [66]
3 years ago
7

The __ is the temperature when the gas becomes a liquid?

Biology
1 answer:
motikmotik3 years ago
8 0
Condensing point of the substance
You might be interested in
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
AnnyKZ [126]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

A pairs with T

G pairs with C

vise versa

3 0
3 years ago
50 POINTS! Pls, I need help. I will give brainliest if you tell me the answer and explain WHY you think so. I'm supposed to rese
galina1969 [7]

Answer: parasitism possibly< this is all i had its a goat

7 0
3 years ago
How does the ocean help to maintain moderate temperatures across the globe? by increasing the wind speed around the globe, by be
astraxan [27]

by increasing the wind speed around the globe

3 0
4 years ago
The cell membrane regulates and controls what kind of
atroni [7]
Biological cell membranes are selectively permeable, which means that the ease and rate of small molecules passing through membranes vary widely. The plasma membrane regulates exchange of nutrients, oxygen, inorganic ions, waste products, and water. The cellular membrane’s molecular organization controls permeability.
6 0
4 years ago
Sea Daisies, a new class of echinoderm was discovered in 1986. They have the following characteristics: they look like sea stars
svetlana [45]

they were classified as echinoderms and not as a new phylum because they have the attribute of the echinoderm where they were seen as the sea stars without arms, they live in the deep ocean.

<h3>What is an echinoderms?</h3>

An echinoderm  can be described as the any member that can be attributed to the phylum Echinodermata.

The members of this family can be seen as one that posses a recognisable radial symmetry which help in the process of their classification, and some of the members that fall into this caetegories are:

  • starfish
  • brittle stars
  • sea urchins
  • sand dollars
  • sea cucumbers
  • "stone lilies

It should be noted that the phylum can be seen as the level of classification or taxonomic rank  that can be seen below kingdom.

In conclusion, the Sea Daisies which was thenew class of echinoderm that was discovered in 1986 can be classified as the echinoderm and not as phylum since they have the feautures of the echinoderm.

Read more about phylum at:

brainly.com/question/586233

#SPJ1

4 0
1 year ago
Other questions:
  • Add 4.503 m and 6.23 m, using significant digits. How many significant digits would the answer contain?
    12·1 answer
  • Unlike New World monkeys, hominines 
    15·1 answer
  • Kingdom Fungi is most closely related to what other kingdom?
    5·2 answers
  • Anyone know the answers? ​
    9·1 answer
  • Which of the following lists the layers of the Earth from hottest to coolest?
    12·2 answers
  • The functions of carbohydrates do NOT include:
    6·1 answer
  • At birth Himalayan rabbits are usually
    12·1 answer
  • Let’s say two items which are balls, are very identical and were dropped at the same times and same height, fell at different ti
    11·1 answer
  • Please help <br> thank you
    5·1 answer
  • A codon is ______ bases long on a _____.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!