1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natima [27]
3 years ago
13

Which component of the cytoskeleton is the biggest in diameter?

Biology
1 answer:
harina [27]3 years ago
6 0

Answer: Microtubules

Explanation:

The cytoskeleton is a three-dimensional network of proteins that provides internal support in the cells, organizes the internal structures and intervenes in the phenomena of transport, traffic and cell division. In eukaryotic cells, it consists of actin filaments, intermediate filaments and microtubules.

<u>The microfilaments maintain the shape of the cell.</u> Other functions are the formation of cytoplasmic protuberances such as pseudo and microvilli, participating in intercellular or cell-matrix junctions, signal transduction, cell mobility (in the case of muscle cells, and together with myosin, they allow muscle contraction) and in animal cell cytokinesis, the formation of a contractile ring that divides the cell in two.

<u>Intermediate filaments are fibrous protein filaments which constitute the most stable (supporting organelles by their strong bonds) and heterogeneous components of the cytoskeleton.</u> Their main function is to organize the internal three-dimensional structure of the cell (for example, they are part of the nuclear envelope and the sarcomers). They also participate in some intercellular junctions (desmosomes).

<u>Microtubules are tubular structures that originate in microtubule organizing centers and extend along the cytoplasm. They can be polymerized and depolymerized according to the needs of the cell</u>. They are found in eukaryotic cells and are formed by the polymerization of a dimer of two globular proteins, alpha and beta tubulins. Each microtubule is composed of 13 protofilaments formed by the tubulin dimers. <u>They are involved in various cellular processes involving displacement of secretion vesicles, movement of organelles, intracellular transport of substances, as well as in cell division (mitosis and meiosis), since they form the achromatic spindle. In addition, they constitute the internal structure of cilia and flagella. </u>

Microtubules are composed of a protein called tubulin and they are the largest type of filament and its diameter is about 25 nanometers (nm). While actin filaments are made of actin and they are smaller, with a diameter of about 6 nm. And intermediate filaments have a diameter of about 10 nm, which is intermediate between the diameters of the two other principal elements of the cytoskeleton.

You might be interested in
The synthesis of sugar molecules through the process of photosynthesis requires energy absorbed from sunlight. Bearing this in m
Serga [27]

Answer:

endothermic reaction

Explanation:

This means it cannot occur without energy (from the Sun).

6 0
1 year ago
Enzymes act as catalysts because ______.
MAVERICK [17]
B - Enzymes act as catalysts because they lower the activation energy
5 0
3 years ago
What are the sides of the DNA ladder made of?
sweet-ann [11.9K]
They consist of double-bond and single bond, according to the type of DNA.
7 0
3 years ago
Read 2 more answers
Calculate the distance the Aleutian Island chain is from the convergent plate boundary.
Pavlova-9 [17]

Answer: 2,000 miles.

Explanation:

The Aleutian Trench, which has formed along the convergent boundary and has been produced by the subduction of the oceanic plate, extends for 2,000 miles.

8 0
2 years ago
Your patient was hit in the chest by a piece of shrapnel from a bomb. this is an example of a​ _____ phase injury.
lesya692 [45]
This is an example of a Secondary phase injury.


Hope this helped you! c:
6 0
3 years ago
Other questions:
  • What is the best description of chromosomes by the end of anaphase 2 of meiosis
    12·2 answers
  • According to the preface to The Pluto Files, what best describes the information the book will include?
    10·2 answers
  • Which of the following is NOT a conifer? ginkgos
    12·2 answers
  • Which assumption must be correct for a population to be in hardy-weinberg equilibrium for a specific gene? see section 23.1 ( pa
    11·2 answers
  • Cell division is an essential stage, and eventual result, of every organic cell cycle. What are the different types of cell divi
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Explain how living things, such as people and trees, are different from nonliving things, such as rocks and the tent.
    5·2 answers
  • Which of the following is not true of lymphatic capillaries?
    8·1 answer
  • Summarize the four steps to natural selection
    7·1 answer
  • Explique por qué a los protistas se le consideran un grupo polifilético-
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!