1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gre4nikov [31]
3 years ago
13

A cell biologist found that two different proteins with different structures were translated from two different mRNAs. These mRN

As, however, were transcribed from the same gene in the cell nucleus. Which mechanism below could best account for this?
Biology
1 answer:
Ivanshal [37]3 years ago
3 0

Answer:

Alternative splicing

Explanation:

One gene can lead to multiple proteins by the alternative splicing of the mRNA. The alternative splicing is the most common process that contributes to protein diversity at a pot-transcriptional level. This process is carried out by different combinations of including or excluding exons of the mRNA, obtaining proteins that differ in their amino acids sequence, consequently having different biological functions.

You might be interested in
What is the location within a cell where cellular respiration occurs?
Eva8 [605]
I believe the answer is C.
5 0
3 years ago
Read 2 more answers
NEED ASAP! How does the amount of food in a meal effect the time it takes to digest
Alona [7]

Answer:

because the items in a meal are all different and digest differently

5 0
3 years ago
CER (Claim, Evidence, Reasoning). Is a virus a living thing?​
MissTica

No, they are not, without cells of a living thing, they would not be able to multiply.

8 0
3 years ago
What is the difference between mitosis and meiosis?
olchik [2.2K]
Meiosis is two rounds of genetic seperation while, mitosis only has one. Both of these process of cell division and replicating is associated with cytokinesis.<span>The end result of both are daughter cells produced from a parent cell</span>
4 0
3 years ago
Read 2 more answers
50 points!!! Which examples describe how a plant might meet the challenge of getting and using energy? Choose all answers that a
spayn [35]

The answers are A and D

Hope this Helps,pleeeeeeeeease vote as brainliest!!!

6 0
3 years ago
Read 2 more answers
Other questions:
  • They are exitable cells that are long and fibrosis. These cells are ready for contraction or the activation of tension for the m
    15·1 answer
  • A new strain of rice was developed to be resistant to popular weed killers. What could be a negative outcome from the production
    7·2 answers
  • Aquatic organisms are able to survive when the temperature decreases. These organisms survive even when the surfaces of lakes an
    12·1 answer
  • Sexual reproduction and mutations are the cause of ______
    5·1 answer
  • is the fluid portion of a blood sample that has been drawn in the presence of an anticoagulant compound.
    8·1 answer
  • Which can be concluded from a comparison of the two phylogenetic trees
    9·2 answers
  • In the human body, the nervous system provides impulses which direct muscles to move, while the contraction of muscles physicall
    7·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • The amount of this protein rises and falls in time with the cell cycle
    6·1 answer
  • In osmosis jones, what represented the blood and blood vessels ?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!