1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Darina [25.2K]
3 years ago
6

anonymous anonymous 2 years ago The diagram above shows creep, which is a type of mass movement. Which of the following usually

causes creep? A. volcanic activity B.freezing and thawing of water beneath the soil C.low water content D.plate tectonics
Biology
2 answers:
Liula [17]3 years ago
5 0
The Answer is D, Plate Tectonics
Westkost [7]3 years ago
4 0
D) Plate Tectonics... Please answer my recent question. I am doing homework and I don't know it LOL.. Well I hope my answer helped!!<span></span>
You might be interested in
2. Just as in humans, systems interact in plants to maintain homeostasis and accomplish the functions of transport, reproduction
Xelga [282]

Answer:

osmosis

Explanation:

plants use osmosis whic is moving water though a semipermial membrane to draw up water.  It moves from places of high conetartions of water (dirt)  has to  is less water (roots). When it does this the plant mains homeostasis by getting water up useing their xylem (tubes in stems) to the leaves.

8 0
3 years ago
Question 3
andrew-mc [135]
I’m sure it’s Biome !
8 0
3 years ago
Can anyone please help me with these questions
Yuki888 [10]
(1) A. (2) D. (3) B. (4) A. (5) B. (6) C. (7) B. (8) B. (9) B. (10) A.
8 0
3 years ago
Nicotine is a drug found in cigarettes that causes blood vessels to constrict. why would a person with a family history of hyper
shusha [124]
Nicotine increases blood pressure to unsafe levels.
4 0
3 years ago
Read 2 more answers
What would be the reason that someone’s eye color would change from blue to green when they were a child?
Butoxors [25]
Your eyes don’t change color, they only reflect the colours around them in particular if they are light coloured eyes. My eyes are blue-grey with a green heterachromia. They are very sensitive to light and dust so they get red easily which makes the eye color appear a brighter blue. If I wear green, the appear more green in color, when I am sunburned they appear more turquoise, etc. But when I wear white or don’t have a shirt on, they look their true blue-grey.
3 0
3 years ago
Read 2 more answers
Other questions:
  • 20 pts! And brainliest if i have enought pts AND u answer in 6 min
    6·2 answers
  • Which of the following is FALSE?
    11·1 answer
  • What is the difference between diploid and haploid cells?
    9·2 answers
  • The smallest unit that ca carry on all the processes of life
    10·2 answers
  • During which phase of the cell cycle do sister chromatids first appear?
    12·2 answers
  • In a diploid organism, there are ___ number of copies of most genes. In a population, there may be many different gene sequences
    8·1 answer
  • The two lower, larger chambers of the heart are called ____.
    5·1 answer
  • The physical characteristics of an organism is its: phenotype. genotype. alleles. gametes.
    11·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Which type of energy resource does not use a turbine to generate electricity?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!