1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aalyn [17]
3 years ago
10

What statement best summarizes the relationship between photosynthesis and cellular respiration? ( 2 points)

Biology
1 answer:
Crazy boy [7]3 years ago
6 0

Answer:

Photosynthesis produces sugars and oxygen. Cellular respiration produces carbon dioxide and water. ... Cellular respiration produces adenosine triphosphate (ATP)

Photosynthesis removes carbon from the atmosphere, and cellular respiration releases carbon back into the atmosphere. ... Only plants perform photosynthesis, and only animals perform cellular respiration.

You might be interested in
On automobiles, what is designed to reduce noise pollution?
Evgesh-ka [11]
B carburetors .......
8 0
3 years ago
Read 2 more answers
Describe the connection of the joints between the bones of the skull.
igor_vitrenko [27]

Answer:

A suture is a type of fibrous joint that is only found in the skull ( cranial suture). The bones are bound together by Sharpey's fibres. A tiny amount of movement is permitted at sutures, which contributes to the compliance and elasticity of the skull. These joints are synarthroses.

7 0
3 years ago
Easy points 1 suggest what the drug longmasterol might do to the body to affect reaction time 2describe the effect of longmaster
Semmy [17]

Answer:

4.Antagonistic muscles are muscles that have opposite effects to one another,As one relaxes, the other contracts.

5, This is to move bones in tandem to cause locomotion.As as one contracts, and the other relaxes, the bone is pulled and this shifts the position of the bone to cause locomotion.Note, a muscle cell usually pull in one direction.,

6. it lacks nucleus to have enough space for oxygen carrying molecules(haemoglobin)it has bi-concave shape to squeeze through tinny capillaries to reach tissues and have large surface area for oxygen carriage.They contain Oxygen carrying pigment Haemoglobin.

1.This is a stimulant that increases the rate of excitability by increasing the synaptic connection through increase in amount neurotransmitters, at synaptic junctions

2,This accelerate the rate of ageing.Leading to premature aging.it ,may affect the heart efficiency and the entire cardiovascular system at the long run.

3. After a period of time this may cause liver damage by blocking blood flows to the liver.It may also lead to inhibitory effect of detoxification activities of the liver.This leads to hepatic failure.

7. A state of matter can only be compressed at  the gaseous state.it can not be compressed at solid because the inter molecular forces are very strong and the molecules of solids are well compact. Molecules of liquids are not free neither, although their molecular force are weak, But the molecules can not be compressed, since they lack random motion.

8. This is due to the lattice arrangement of water molecules in ice, resulting in lesser density of ice compare to that of water. The lower density of ice makes ice to float when it freezes, however, it is the higher lattice arrangement in ice which makes it expand, compare to other liquids which makes it less dense and therefore floats.

10. This can be caused by the force that pull water through the mains to the pipes.it is measures in bars. Thus 1 bar is equal to the force per unit area lifting water to a height of 10 meters.

9. This is to generate a forward thrust, to overcome the aerodynamic drug.The propeller engine generate a thrust, which ensure a steady speed  large enough to overcome the drag

5 0
3 years ago
Which career field would best suit Cam's interests in the following scenario?
LUCKY_DIMON [66]

A, molecular biology

Microbiology includes the study of molecules therefore I believe the answer is molecular biology

7 0
3 years ago
The forest ecosystem is a living resource.<br> a. True<br> b. False
ankoles [38]
The forest ecosystem is a living resource ( true)
7 0
3 years ago
Other questions:
  • Is a cyst filled with a milky fluid containing sperm that develops in the epididymis?
    9·1 answer
  • The sum of the number of protons and neutrons in the atom is known as the _____
    6·2 answers
  • A gene for disease resistance in fir trees is transferred to pine trees using modern DNA technology. How might this be economica
    15·2 answers
  • How to find a gastroenterologist to review medical records?
    10·1 answer
  • Which of the following are part of the anthophyte life cycle? a. haploid cells b. diploid cells c. meiosis d. all of the above
    5·1 answer
  • Why is a “fresh” new volcanic island a good example of a primary succession?
    8·1 answer
  • HELP ME PLS OMG HELP ME PLS!
    12·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • What happens in the small intestine
    8·1 answer
  • If scientists wanted to learn more about evolution by studying
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!