1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qwelly [4]
4 years ago
9

BRAINLIEST if right!

Biology
1 answer:
AURORKA [14]4 years ago
3 0
Congress wanted to raise money for the treasury because the needed to pay off war debts.
You might be interested in
An adaptation that helps trees survive in dry grasslands is _____.
d1i1m1o1n [39]

D) being drought resistant.

6 0
3 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Con qué otro nombre se le conoce al proceso de la mitosis
balandron [24]
La mitosis es un proceso en el que una sola célula se divide en dos células hijas idénticas (división celular). Durante la mitosis una célula? divide once para formar dos celdas idénticas. ... Si no se corrige a tiempo, los errores cometidos durante la mitosis pueden provocar cambios en el ADN? que potencialmente puede conducir a trastornos genéticos?
7 0
3 years ago
Study the diagram below in which order does oxygen flow though the human circulatory system?
Vlad1618 [11]
The answer is 1, 2, 4.
5 0
3 years ago
Read 2 more answers
Malcolm is unable to have an erection and has gone to his doctor to discuss the problem. malcolm's doctor referred to this probl
Radda [10]
Answer is erectile disorder
3 0
4 years ago
Read 2 more answers
Other questions:
  • In humans tongue rolling is dominant to the inability to tongue roll. If a heterozygous tongue roller and a non-tongue roller ha
    14·1 answer
  • The phases of the ovarian cycle include all of the following, EXCEPT
    11·1 answer
  • What does animal cells have that plant cells don't have?
    15·1 answer
  • In the Kirby-Bauer disk diffusion test, the _______ of the zone of inhibition is measured and used for interpretation.
    6·1 answer
  • The ____________ (pipe/vent) is a long tube in the ground that connects the magma chamber to Earth’s surface.
    13·2 answers
  • Which three is a carbon source<br> Factores and Cars<br> Ocean<br> Animals<br> Plants<br> Fossils
    15·1 answer
  • Which process does the diagram represent
    6·1 answer
  • Nitrous oxide (N20) is a gas sometimes used in dental offices. Which of these is the correct
    9·1 answer
  • Recall that heterozygous individuals show the _______________ phenotype but still have a ________________ allele in their genome
    13·1 answer
  • In which of these does a single cell NOT perform all life functions?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!