1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksano4ka [1.4K]
4 years ago
6

Briefly describe the cell cycle is (be sure to include the main parts of the cell cycle)

Biology
1 answer:
adoni [48]4 years ago
7 0

Answer:

Cell cycle can be defined as the the movement of cell through various phases in a cyclic manner to prepare itself for division .This cyclic movement of cell is termed as cell cycle.

Explanation:

Cell cycle basically composed of 2 phases

1 Interphase: It contain 3 subphases

a G1 Phase which deals with the synthesis of RNA and protein.

b  S Phase  which deals with DNA replication.

c  G2 phase which deals with synthesis of RNA and proteins.

2  Mitotic phase: it contain 4 sub phases

a Prophase chromosome condensation along with disappearance of nuclear envelop and nucleolus.

b Metaphase  Arrangement of chromatid in the equatorial plane or metaphase plate.

c Anaphase  movement of chromatids toward the opposite poles of the cells .

dTelophase Reappearance of nuclear envelop and nucleolus in the

newly formed daughter cell with equal number of chromosome in bth cells

Regulation of cell cycle

Cell cycle is regulated by variousfactors such as

1  Maturation promoting factor( MPF) this protein helps in the movement of cell from G2 to M phase.

2 G1  cyclin CDK These proteins helps in the transition of cell from G1 phase to S phase.

3 S cyclin CDK  These proteins helps in the transition of cell from Sphase to G2 phase.

You might be interested in
Question 4 of 10
pogonyaev
The answer will be B. It is common sense
8 0
3 years ago
Frequently, what is the earliest symptom of left-sided heart failure?
mr_godi [17]
Chest pains, shortness of breath
4 0
4 years ago
How can volcanic activity create new landforms?
elena-14-01-66 [18.8K]
If a volcanic reaction takes place and the lava hardens, it creates rock. If it flows into the ocean, it can even create new land.
5 0
3 years ago
Read 2 more answers
A population of prairie dogs lives at the edge of a meadow.
Shalnov [3]

Answer:

B. They belong to the same species and C. They live in the same area.

Explanation:

This is an educated guess. If you think about it, if there was a population of humansss, we dont have the same parents nor the exact genes so to only two that make sense is those to (^ω^)

5 0
3 years ago
Read 2 more answers
What can you use instead of eggs in frog eye salad????
saw5 [17]

Answer: vanilla pudding mix

Explanation:

Hope this helps!!

3 0
3 years ago
Other questions:
  • How does capillary action help sustain life on earth
    5·1 answer
  • Name 5 things our atmosphere does for us
    10·2 answers
  • A food chain or food web can provide good information including _____.
    5·1 answer
  • Why do psychologists always develop a hypothesis at the beginning of a research project?
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • when nicotine binds to nicotinic acetylcholine receptors In the brain, This causes the release of a specific neurotransmitter. I
    11·1 answer
  • A young animal has never had much energy. He is brought to a veterinarian for help and is sent to the animal hospital for some t
    12·1 answer
  • During the industrial revolution in England, a population of light-colored moths population fell while a population of dark-colo
    11·1 answer
  • What is a non-renewable and a renewable source <br> list 5 of both
    10·1 answer
  • Why is incomplete dominance considered an exception?.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!