Answer:
A carbon atom can form up to four covalent bonds as one carbon atom has four valence electrons (in outermost shell). It is a fact that the number of valence electrons in a atom determines the number of covalent bonds it will form. Thus, each electron in carbon atom is used to form four covalent bonds with various four atoms.
Explanation:
A bond between a carbon and hydrogen atom is a non-polar covalent bond. The non-polar covalent bond are the bonds between two atoms which share equal number of electron(s) with each other. Example: as in case of methane, where one carbon atom shares its 4 outer valence electrons with four hydrogens by sharing equal number of electron.
In contrast, polar covalant bond are the bonds between two atoms which share unequal number of electron(s) with each other. Thus these bonds are partially ionic.
Answer: The first answer is 3 and the second answer is c
Explanation:
Answer:
barbiturate/sedatives
Explanation:
Lateralization is a process of studying the split functions of the brain hemispheres. The most common test used for testing lateralization is obtained from sodium amytal studies. In this study a barbiturate or a sedative is injected into the carotid artery either left or the right artery. So, till the time the barbiturate hampers the functioning of any hemisphere, the functions associated with that hemisphere also gets hampered or are sustained for a while. This technique is of invasive nature
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
<u>Isotonic</u>
Explanation:
If the solute concentration of the cell and that of its surrounding medium are the same there will be no net flow of water in either directions. In this case, the external solution is said to be isotonic to the cell.
Both the cytoplasm concentration and the glucose in the test tube are the same.
