1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PSYCHO15rus [73]
2 years ago
14

Does the nucleus control the cell membrane?

Biology
2 answers:
Salsk061 [2.6K]2 years ago
7 0
Yes it does beucase cell nucleus controls the other things
Sloan [31]2 years ago
7 0
Yes it's like the brain of the cell that's how my teacher described it
You might be interested in
Help<br> me<br> please<br> it just those ones
jeka57 [31]

Explanation:

Solids:

Particles stay close together with a pattern

Particles do not flow freely

Definite shape and definite volume

Liquids:

Particles are closer together (compared to gas) with somewhat of a pattern

Particles flow freely

Somewhat strong attractive forces that hold an indefinite shape

Gas:

Particles spread out without a pattern

Particles flow everywhere (they are like kids on a sugar rush)

Weak attractive forces that hold no shape or volume

Indefinite shape and indefinite volume

Not entirely sure what compressibility is so i skipped that one for all of them

5 0
3 years ago
Which occurs during translation
RideAnS [48]

Answer:

Translation occurs in a structure called the ribosome, which is a factory for the synthesis of proteins. ... Translation of an mRNA molecule by the ribosome occurs in three stages: initiation, elongation, and termination. During initiation, the small ribosomal subunit binds to the start of the mRNA sequence.

Explanation:

7 0
3 years ago
FOODS RICH IN<br>CARBOHYDRATESfood rich in carbohydrates and fats and proteins ​
MaRussiya [10]

Answer:

Unhealthy high carbohydrate foods include pancakes, soft pretzels, bread products, ready to eat cereals, milkshakes, ice-cream, cereal bars, cake, pies, muffins, sweetened canned fruits, sugary drinks, fruit juices, corn chips, potato chips, and candies. Healthy high carbohydrate foods includes whole grains, beans, vegetables, fresh fruits, nuts, and seeds. The daily value (%DV) for carbohydrates is 300 grams.

High fat foods are eggs,Avacado ,fish,Faith products..

High protein foods are flesh of chicken,fish,goat,etc & Dairy products

Mark me as brainlist ♥️✌️♥️✌️

7 0
3 years ago
Where does the male human body store sperm until it reaches full maturity?
statuscvo [17]
Once the sperm cells are formed, the are stored in the epididymis, where they are temporarily stored while they mature.

Hope this helps :)
6 0
2 years ago
Read 2 more answers
In x linked recessive if the mother is carrier and father is normal and their first child is male and is affected the next child
Phantasy [73]

Answer:

A 50% chance I believe. The mother will always give the X chromosome and since the father is normal and doesn't carry that ressecive trait they can only get it from the mother. (I'm not completely sure!))

6 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What are the building blocks of minerals?
    8·1 answer
  • Why has acid rain become an international problem??
    5·1 answer
  • What are the character of the eukaryotic cells
    10·1 answer
  • Carbon dioxide emissions are contributing to climate change, which is causing average global temperatures to increase. These tem
    10·2 answers
  • A new type of fish has been discovered. It has vibration receptors on its snout and virtually nonexistent eyes. Based on these c
    7·1 answer
  • How did Pasteur’s experiment with tech flasks help disprove the idea that living things could just appear or come from non livin
    11·1 answer
  • A universal human symbol that can be seen in a dream is a(n) __________.
    13·2 answers
  • Papaya leaves have veins that resemble fingers diverging from a palm. Papaya leaves are an example of which venation pattern?
    8·2 answers
  • Fill in the blanks with the correct number. Mitosis results in ___genetically identical cells
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!