1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
castortr0y [4]
2 years ago
7

What are two natural resources of air pollution

Biology
1 answer:
aksik [14]2 years ago
6 0

Answer:natural sources, including volcanic eruptions, windblown dust, sea-salt spray and emissions of volatile organic compounds from plants.

Explanation:

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
A group of plant eating animals are separated from their population. In the new environment, the only edible vegetation grows on
slavikrds [6]

Answer:

dont know

Explanation:

4 0
3 years ago
8(b)(i). Diagram 8.2 shows part of the Periodic Table. State the type of<br>element for P. *<br>​
chubhunter [2.5K]

Answer:

<u><em>Phosphorus</em></u>

Phosphorus is a chemical element with the symbol P and atomic number 15. Elemental phosphorus exists in two major forms, white phosphorus and red phosphorus, but because it is highly reactive, phosphorus is never found as a free element on Earth.

Explanation:

Brainliest?

6 0
2 years ago
_____ is the term used to describe the biochemical representation of our experiences within the brain, which are known to deteri
vlabodo [156]

Answer:

The answer is <u>Memory trace.</u>

Explanation:

  • <u><em>a hypothetical permanent change in the nervous system brought about by memorizing something; an engram.</em></u>
8 0
2 years ago
Can anybody answer this
NARA [144]

Answer:

Options A, B, E, and F are correct

Explanation:

A). In the cell cycle, DNA replication is a process by which a duplicate DNA strand is produced with the help of replication machinery (enzymes, nucleotides, etc.). The overall process ensures that the newly developed strand is free of any mutations (errors) causing the production of wrong proteins at later stages. Although, there are chances of positive, negative or neutral mutations, the replication machinery aims to avoid any such errors at this stage.

B). DNA stores genetic information in the form of codes (known as codon) which needs to be translated in the form of proteins. This process is known as a transcription by which messenger RNA (mRNA) is produced in the nucleolus. Thereon, it is transported outside to encode proteins with the help of ribosomes. The process of copying genetic information on DNA in the form of mRNA is known is transcription.

E). The figure shown is also known as the central dogma of life. According to which, DNA (genetic information) is transcribed into RNA, which is then translated to proteins. In brief, RNA molecules brings the information from nucleous to ribosomes and make proteins. These proteins are often enzymes, hormones, and other biomolecules that perform the important functions in living organisms.

F). DNA and RNA are two types of nucleic acids responsible for all types of life on Earth. Since both of them are well recognized as nucleotides, they are made up of the same genetic building blocks known as nucleotides. Further, each nucleotide is comprised of a five-carbon sugar, a phosphate group, and a nitrogen base. The sequence of these nucleotides is responsible for the production of specific types of proteins.

3 0
3 years ago
Other questions:
  • Which respiratory structure is comprised of cartilage and ligaments?
    7·1 answer
  • Which process does the Sun use to produce energy? solar fission solar fusion nuclear fission nuclear fusion
    10·2 answers
  • Whay can piranhas do in minutes?
    11·1 answer
  • Name three common factors that can increase the risk of someone developing an aneurysm.
    9·1 answer
  • Which of the following forms would you use to gain insight into the daily nutritional habits of a client
    15·1 answer
  • Mitosis and meiosis are methods of cell division.
    15·2 answers
  • Ayudaa
    15·1 answer
  • The Small channels of spongy bone that are filled with marrow are most accurately named ______.
    11·2 answers
  • HURRY PLEASE!
    11·2 answers
  • !!!!! Which of the following statements best describes the climate of an area rather than its weather conditions?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!