1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alborosie
3 years ago
9

The cell membrane, cytoplasm, and nucleus are collectively called the

Biology
2 answers:
gayaneshka [121]3 years ago
8 0

STRUCTURE OF THE CELLS I THINK

ira [324]3 years ago
7 0

It is the structure of the cells.

Biology. Hope this helps.

You might be interested in
Reproductive isolation is _____.
otez555 [7]

Answer:

The answer is D.

Explanation:

Reproductive isolation is where a species can't breed with any other species except its own.

4 0
3 years ago
Why do we itch? Is it an evolution thing?
Brut [27]

Answer:

we itch reacting to stimuli like when ee get poked we react and so on. And it not an evolution

4 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
What is a bacterial have?
larisa [96]

Answer:

A.because dna is our blood not sure

7 0
3 years ago
Read 2 more answers
Which of these is a solution? <br> a. oil and water <br> b. soda pop <br> c. h2o
sertanlavr [38]
B.) Soda pop is the solution among them........
8 0
3 years ago
Other questions:
  • Similarities between rotating earth and non rotating earth
    5·1 answer
  • What is one organism that has Capsular Polysaccharides Enhance Virulence. Describe the bacterium, important characteristics,dise
    13·1 answer
  • Differentiate between the habitat and niche of an organism that is found in your community
    8·1 answer
  • What is the Calvin cycle?
    14·1 answer
  • Scientists believe that Earth and the other planets formed _____.
    10·2 answers
  • The aloe plant has thick, water-filled leaves covered with spikes. The flowers are high on a stalk, so that pollen can be quickl
    5·2 answers
  • To which sub-kingdom does paramecium belong to? Please give a reason for your answer.
    11·1 answer
  • Based on observations of natural phenomena is it a scientific theory
    12·1 answer
  • What structure pull the chromosomes apart
    13·2 answers
  • What effect do enzymes have on chemical reactions?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!