1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex73 [517]
3 years ago
15

Which statement BEST describes the relationship between adenosine diphosphate (ADP) and adenosine triphosphate (ATP)?

Biology
1 answer:
Tems11 [23]3 years ago
7 0

<em>Complete question:</em>

<em>A. With an input of energy, ADP rearranges to become ATP. </em>

<em>B. Without any energy change, ADP rearranges to become ATP. </em>

<em>C. With an input of energy, ADP combines with a phosphate group to become ATP. </em>

<em>D. With a release of energy, ADP combines with a phosphate group to become ATP.</em>

<em />

Explanation:

C. With an input of energy, ADP combines with a phosphate group to become ATP.

In respiration, energy is released when a phosphate group is removed from ATP; ATP is formed from the phosphorylation of ADP with an inorganic phosphate, Pi, which forms an unstable, high energy phosphate bond.

ADP + inorganic phosphate (Pi) + energy → ATP

Further Explanation:

In all eukaryotic cells mitochondria are small cellular organelles bound by membranes, these make most of the chemical energy required for powering the biochemical reactions within the cell. This chemical energy is stored within the molecule ATP which is produced. Respiration in the mitochondria utilizes oxygen for the production of ATP in the Krebs’ or Citric acid cycle via the oxidization of pyruvate through the process of glycolysis in the cytoplasm).

This forms a gradient where there is a differential in the number of protons on either side of the membrane the protons flow or re-enter the matrix through the enzyme ATP synthase, which makes the energy storage molecules of ATP from the reduction of ADP. At the end of the electron transport, three molecules of oxygen accept electrons and protons to form molecules of water-  a process called chemiosmosis.

Learn more about cellular life at brainly.com/question/11259903

Learn more about cellular respiration at brainly.com/question/11203046

#LearnWithBrainly

<em />

<em />

You might be interested in
Enter the sequence of the DNA coding strand with a 5-3 polarity. DO NOT WRITE 5 OR 3 OR 5' OR 3' IN THE BOX!
Charra [1.4K]

Complete question:

Use the sequence below to answer the following questions  

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’  

5’-TGCCTAGGAGGGATCACGCATTATGC-3’  

1. Enter the sequence of the coding strand with a 5’-3’ polarity

Answer:

coding strand → 5´- GCATAATGCGTGATCCCTAGGCA -3´

Explanation:

When referring to the <u>coding strand</u>, we are talking about the sequence that turns to be the same as the mRNA that results from the transcription of the same DNI segment -switching bases T for U-.  

The coding strand receives that name because it is the sequence that codes for each amino acid composing the proteins.

When the DNI molecule separates into two strands to form the transcription bubble, we can identify two separate segments: coding strand and template strand.  

The coding strand goes in direction 5´ to 3´, while the complementary strand -template strand- grows in direction 3´ to 5´.  

Whenever we have a DNI molecule and we need to determine which strand is the coding one, we just need to look for the presence/absence of start or stop codons.

So, in the exposed example we have two strands, but we do not know yet which one is the coding one.

Conventionally, the first strand is always the coding one. However, let us analyze it by using the presence/absence of codons.

First-strand:

3’-ACGGATCCTCCCTAGTGCGTAATACG-5’

let us write it is 5´to 3´direction

5´- GCATAATGCGTGATCCCTAGGCA -3´

now let us identify the start and stop codons in 5´⇒3´direction.

  • Start codon ⇒ ATG
  • Stop codon ⇒ TAA, TAG, TGA

5´- GCATA<u>ATG</u>CGTGATCCCTAGGCA -3´ ⇒ 1 start codon at the beginning

5´- GCA<u>TAA</u>TGCG<u>TGA</u>TCCC<u>TAG</u>GCA -3´ ⇒ 3 Stop codons

Second strand: We will do exactly the same procedure

5’-TGCCTAGGAGGGATCACGCATT<u>ATG</u>C-3’⇒ 1 start codon near the end

5’-TGCC<u>TAG</u>GAGGGATCACGCATTATGC-3’⇒ 1 stop codon at the beginning

What we did here was to identify in both provided strands, where the start and stop codons are placed. We can see that in the first strand we have the start codon near the beginning, while in the second strand we have it near the end of the sequence. From this information, we can assume that the first strand is the coding one. <em>However, you need to know that some coding sequences do not have start and stop sequences, because they might correspond to a sequence in the middle of a gene.</em>

So, the sequence of the DNA coding strand with a 5-3 polarity is

5´- GCATAATGCGTGATCCCTAGGCA -3´

8 0
3 years ago
The epiglottis prevents food and water from entering the _____. The _____ contains special cells that filter air. Air mainly ent
baherus [9]

Answer:

Its

Larynx

Nasal cavity

Nose

Pharynx

Trachea

Explanation:

5 0
3 years ago
Read 2 more answers
What does replication mean?
Sonja [21]

Answer:

process of copying DNA prior to cell division

5 0
3 years ago
Read 2 more answers
Will some of the 30 children have hemophilia
ANEK [815]
30% and 70% dont usally suffer from excess bleeding
7 0
3 years ago
Changes in temperature, pressure, and _____ affect gases more than solids or liquids.
sleet_krkn [62]

Answer:

Changes in temperature, pressure, and Volume affect gases more than solids or liquids.

Explanation:

hmm I guess..........

4 0
3 years ago
Other questions:
  • If two species are branching off of the same node in a phylogeny, is it possible to tell which species evolved first?
    5·1 answer
  • When compared to generation x, members of generation y are most likely to influence?
    13·1 answer
  • The primary difference between a naturalistic observation and a laboratory observation is the degree of
    12·2 answers
  • How is a universal genetic code similar to the hypothesis about the origin of life on Earth?
    8·1 answer
  • A bag of garden soil has a mass of 3 kilograms.
    13·1 answer
  • Small rocks weather more quickly than large rocks because, compared to their volume, the surface area of small rocks is
    9·1 answer
  • What components does the chemical level include
    11·2 answers
  • Scientists believe that there are three jeans what contribute to skin color in humans.
    9·1 answer
  • What tests can be used to diagnose phenylketonuria?
    13·2 answers
  • Inside cells, special molecules carry messages from the membrane to the nucleus. Which body system uses a similar process?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!