1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Helga [31]
3 years ago
11

What do blue tailed lizards eat and drink?

Biology
1 answer:
Fantom [35]3 years ago
6 0
Insects, worms beetles, caterpillars, their own eggs
You might be interested in
A protein is 300 amino acids long. Which of the following could be the number of nucleotides in a bacterial gene that codes for
butalik [34]

Answer:

2) 100

Explanation:

  • Every 3 nucleotides in an mRNA specifies the addition of one amino acid in a protein.
  • Each three-letter "word" which is the combination of nucleotides is called a codon.
  • Therefore, amino acids are coded by a series of three-letter "words" - a 300 nucleotide mRNA will code for a 100 amino acid protein.
7 0
3 years ago
Which pair of terms could be used to describe the location of the nose when compared to the location of the eyes
stiv31 [10]

The pair of terms used to describe the location of the nose

when compared to the location of the eyes are medial and

inferior.

<h3>What is Location?</h3>

Location refers to the exact position of a particular object or

organism. In humans, location of different parts of the body

varies.

The location of the nose is medial to the eyes which means it is

found in the mid-line region of the eyes. The nose is also

inferior to the eyes as it is found in the lower region of where

the eye is located.

Read more about Location here brainly.com/question/1401793

6 0
2 years ago
If an organism of unknown genotype is crossed with a homozygous recessive organism
Zigmanuir [339]
It’s must be an dominant
5 0
3 years ago
6 letter word: a stack of thylakoids in a chloroplast
Salsk061 [2.6K]
Would It be the Stroma?
6 0
3 years ago
Drag each label to the correct location on the image.
sladkih [1.3K]

Answer:

producer: grass, primary: grasshopper, secondary: frog, tertiary: snake

Explanation:

3 0
2 years ago
Other questions:
  • Which of the following qualities are NOT associated with mineral luster a.opaque
    7·1 answer
  • Proper use of a condom during sexual activity does not guarantee protection against stis.
    14·1 answer
  • Could life have survived deep below the surface of ancient earth
    6·1 answer
  • Scientist Year
    6·2 answers
  • How could newborns be infected with this bacterium that is normally found in the soil, water, and feces?
    10·1 answer
  • Which of the following is not a source greywater?
    13·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • This map shows the counties in Montana that are prone to dam failure. If you were in charge of flood control in Montana, where w
    5·2 answers
  • Rivers and streams are biodiverse ecosystems that are sensitive to change. please select the best answer from the choices provid
    7·1 answer
  • The colon is divided into two sections called the ascending transverse and descending transverse. True False
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!