1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maksim [4K]
3 years ago
6

Scientific thinking: what roles do diet and the microbial community in the intestines play in obesity?

Biology
2 answers:
crimeas [40]3 years ago
7 0

Studies showed that a person’s diet and their gut microbes interact and affect obesity. There is a difference between the gut microbes of a lean person and an obese person. An obese person has less-diverse microbial communities, compared to a lean person. However, a person’s gut microbes depend on his/her diet. Having a healthy diet (high in fiber, low in saturated fats) produces and encourages more lean gut microbes, which means that this can prevent or lessen obesity.

Nutka1998 [239]3 years ago
3 0

The microbial community has role in digesting certain food which is not possible in the absence of microorganism in the intestines. By this food (fat) accumulate in the body and leads to obesity.

Further Explanation:

Microorganisms are mainly present in our digestive tract. They are helpful in digesting the food molecule. These microorganisms have their own preference over the food. They metabolize different kind of food molecule and release their by product in the intestine. These by-products can easily be absorbed by body.

Obesity is a kind of a disease that mainly involves accumulation of high amount of fat inside the body. It is a medical problem which increases the risk of heart problems, high blood pressure, diabetes, and other diseases  

Scientist discovered that increased amount of nutrients such as sodium, trans-fat, saturated fat, or cholesterol in the diet might elevate the risk of heart diseases, high blood pressure, and cancer. They are not easily digested by our body and accumulate in the body. Therefore, these nutrients need to be controlled in the diet.

Learn more:

1. Learn more about carbohydrate monomer brainly.com/question/6947177

2. Learn more about core muscle stabilization brainly.com/question/1231927

3. Learn more about energy storage brainly.com/question/523624

Answer Details:

Grade: High School

Subject: Biology

Topic: Obesity

Keywords:

Obesity, body, diet, health, by product, high amount, trans fat, cholesterol, saturated fat, sodium, intestine, micro-organism, food.

You might be interested in
Which best describes the storage of the genetic code?
Musya8 [376]

Answer:D

Explanation:

Because The genetic code by which DNA stores the genetic information. The functional segments of DNA which code for the transfer of genetic information are called genes

5 0
3 years ago
Read 2 more answers
Does social distancing increase or decrease your carbon footprint?
Andrej [43]

Answer:

Decrease

Explanation:

The carbon footprint is <u>the amount of carbon (in terms of greenhouse gases) being emitted by human activities</u>. In a situation where <u>social distancing is encouraged, human activity would reduce significantly</u>. Very few people will be outside and the causative agents of pollution (anthropogenic) will be significantly reduced. Further, nature would be able to minimize the impacts of pollution when human activities are less than the threshold capacity.

Let's take an example of coronavirus spread globally this year. The social distancing of 2 meters has significantly reduced the number of people going outside. Ultimately, there are fewer automobiles on the roads and a few industries are running. The result is that the air quality index has been significantly improved. For example, in India, people from 300 km away, can see the Himalayan mountain range very clearly (see image attached). This has not happened in decades after modern industrialization.

4 0
3 years ago
Memory cells may take the form of B cells. T cytotoxic cells. T helper cells. All of the choices are correct.
topjm [15]

Answer:

Having considered how an appropriate primary immune response is mounted to pathogens in both the peripheral lymphoid system and the mucosa-associated lymphoid tissues, we now turn to immunological memory, which is a feature of both compartments. Perhaps the most important consequence of an adaptive immune response is the establishment of a state of immunological memory. Immunological memory is the ability of the immune system to respond more rapidly and effectively to pathogens that have been encountered previously, and reflects the preexistence of a clonally expanded population of antigen-specific lymphocytes. Memory responses, which are called secondary, tertiary, and so on, depending on the number of exposures to antigen, also differ qualitatively from primary responses. This is particularly clear in the case of the antibody response, where the characteristics of antibodies produced in secondary and subsequent responses are distinct from those produced in the primary response to the same antigen. Memory T-cell responses have been harder to study, but can also be distinguished from the responses of naive or effector T cells. The principal focus of this section will be the altered character of memory responses, although we will also discuss emerging explanations of how immunological memory persists after exposure to antigen. A long-standing debate about whether specific memory is maintained by distinct populations of long-lived memory cells that can persist without residual antigen, or by lymphocytes that are under perpetual stimulation by residual antigen, appears to have been settled in favor of the former hypothesis.

6 0
3 years ago
Which term describes this example? A rabbit's cells have two sex chromosomes that are different.
Arlecino [84]
This is described to be an allele
7 0
3 years ago
Read 2 more answers
What is the structural formula for saturated fatty acid?
tia_tia [17]

Answer:

The chemical structure of a saturated fatty acid exhibits each carbon bonding to the adjacent carbon with single bonds. Each carbon is also bonded to two hydrogen atoms. The linear nature of saturated fatty acids allows for tightly packed formations, causing them to be solid at room temperature

3 0
3 years ago
Other questions:
  • In the fictional hobbit, there exist 5 alleles of the foot size gene:
    13·1 answer
  • Rue or false: fewer than half of the adult u.s. population engages in 30 minutes of moderate-intensity aerobic activity most day
    6·1 answer
  • 
    9·1 answer
  • According to cell theory, viruses are considered nonliving because they
    15·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Quick Please !!!!! Farmers take water from a pond to water their crops. The farmers notice fish begin to die after the removal o
    5·1 answer
  • Create a food chain with the following organisms. Be sure to identify each organism as a primary producer, primary consumer, sec
    10·1 answer
  • Is dirt biotic or abiotic
    5·1 answer
  • Moss often grows on trees.the tree is not affected ,while the moss has the nutrients it needs to grow.what type of relationship
    7·1 answer
  • All atoms and molecules have mass and are therefore…
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!