1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natalka [10]
3 years ago
5

How are producers, consumers, and decomposers categorized?

Biology
2 answers:
atroni [7]3 years ago
8 0

Answer:

Producers, consumers, and decomposers are organisms within ecosystems that are classified based on how they gain their nutrition

Explanation:

Producers such as plants make their own food, consumers such as animals eat plants and animals, and decomposers such as bacteria and fungi break down dead organic matter.

lutik1710 [3]3 years ago
6 0

Answer:

Producers, consumers, and decomposers are organisms within ecosystems that are classified based on how they gain their nutrition. Producers such as plants make their own food, consumers such as animals eat plants and animals, and decomposers such as bacteria and fungi break down dead organic matter.

Explanation:

You might be interested in
The most important force that creates tides is the gravity of the ____________________.
Andrews [41]
Moon. The force of the moon constantly pulls the ocean and pushes the ocean.
8 0
3 years ago
Read 2 more answers
Make one claim about the buffalo population
Annette [7]

The buffalo population in the Serengeti was regulated by adult mortality which was caused by undernutrition as a result of food shortage. ... The effect of interspecific competition could result in a complex regulation of populations through their food supply.

4 0
2 years ago
What<br> is added to make RNA?
Anarel [89]
Three of the four nitrogenous bases that make up RNA — adenine (A), cytosine (C), and guanine (G) — are also found in DNA. In RNA, however, a base called uracil (U) replaces thymine (T) as the complementary nucleotide to adenine (Figure 3). ... (Remember, DNA is almost always in a double-stranded helical form.)
5 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Gizmo: Rainfall and Bird Beak Evolution
solniwko [45]
I believe the answer is spring
3 0
3 years ago
Other questions:
  • which of the following resulted from codominance? 1)a person with AB blood type 2)a flower with pink petals 3)a rabbit with whit
    6·1 answer
  • Money pooled from small investors and used to purchase government or corporate bonds
    14·1 answer
  • The process by which evolution occurs is called
    6·1 answer
  • People eyes can be blue green
    8·2 answers
  • To calibrate the x-axis for 14C decay, you have to convert half-lives to number of years. Recall that 14C has a single half-life
    5·1 answer
  • The element with an atomic number of 4 is?
    7·1 answer
  • What important role does Fire play in a grassland biome ​
    12·1 answer
  • The ___ connects with all the muscles in the body and allows them to move
    11·1 answer
  • The humanistic perspective emphasized the importance of___. A. reciprocal determinism B. self-determination C. free association
    12·2 answers
  • For one half of the year, the north end of Earth’s rotation leans toward __
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!