1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mariana [72]
3 years ago
12

Which statement is true regarding DNA?

Biology
2 answers:
Katarina [22]3 years ago
5 0
<span>The true statement regarding DNA is A) contains deoxyribose sugar. DNA (deoxyribonucleic acid) consists of two strands of nucleotides joined by hydrogen bonds. Each nucleotide contains nucleobase (adenine, thymine, cytosine, and guanine), a sugar deoxyribose, and a phosphate group. The fact that it contains the deoxyribose sugar was the reason the molecule is called deoxyribonucleic acid or DNA.</span>
TEA [102]3 years ago
4 0

A. it's the D in DNA the rest describe RNA

You might be interested in
If I breed a short for FF female with a short for Ff male then I will expect to see what type of offspring
Usimov [2.4K]
If being short is the dominant trait, then you should expect the offspring to also be short.

This is because the traits are spread out as four different possibilities. Either FF, FF, Ff, or Ff. If the dominant trait is being short, “F” then this would mask the recessive trait “f”.
5 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Coral reefs are structures in the ocean composed of the hard exoskeletons of many species of coral. They reproduce simultaneousl
Katarina [22]
I think gamete incompatibility. 
3 0
3 years ago
If you were standing at the North Pole, where would Polaris be located
Novay_Z [31]

Answer:  A) At your zenith

Explanation: Because Polaris, The "North Star", Is located alost directly over the Earth's North Pole. FUN FACT: This star was also used by sailors to navigate when maps could not be used

6 0
3 years ago
Which part Of a DNA molecule is responsible for the direction coding of specific traits of an organism
aksik [14]
Nucleotides - they are molecules present in cells and are formed by nitrogenous bases
4 0
2 years ago
Other questions:
  • Beth learned in her science class that white blood cells in the human body capture harmful material by engulfing them. Then they
    13·1 answer
  • Ionization energy is the amount of energy necessary to _____.
    12·1 answer
  • Where do scientists obtain primers to be used in pcr and in this technique answer?
    15·1 answer
  • Ovulation involves the release of the _____________ from a vesicular follicle.
    10·1 answer
  • Insulin helps maintain glucose levels in the blood. If blood glucose levels got very high, what would you expect to see happen t
    9·1 answer
  • Please im in class right now
    5·1 answer
  • Just need to identify this stuff
    12·1 answer
  • What is the answer to number 1
    5·1 answer
  • What is the relief of the topographic map below <br><br> Please help I’ll give brainliest
    12·1 answer
  • What value would be returned based on the formula in cell a49
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!