1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
myrzilka [38]
4 years ago
9

True or false? Peptidoglycan is a polysaccharide found only in bacteria.

Biology
1 answer:
Trava [24]4 years ago
6 0
It’s True..................
......
.........
You might be interested in
The Hawaiian state bird, the Nene, has an uncertain evolutionary history. It is thought that it has evolved from some other type
lana66690 [7]

Answer:

It will address the research question of what type of goose (species) does the Nene evolved from.

Explanation:

Genomics uses the whole set of an organisms DNA to study and understand its' function, structure, and evolution. Scientists will use the Nene's genome set to study its evolution,basically telling a story where it comes from.

7 0
4 years ago
The sunflower plants shown are the same species. The differences in
tia_tia [17]

Answer:

The sunflower plants shown are the same species. The differences in

height among the plants is an example of variation

Explanation:

Variation entails difference in a condition which is exactly what happened as regards sunflower plant with different height

5 0
3 years ago
Is the vagus nerve the heart rate centre of the brain?
koban [17]

Answer:

The vagus nerve has two bunches of sensory nerve cell bodies, and it connects the brain stem to the body. It allows the brain to monitor and receive information about several of the body’s different functions.

Explanation:

The vagus nerve is the longest and most complex of the 12 pairs of cranial nerves that emanate from the brain. It transmits information to or from the surface of the brain to tissues and organs elsewhere in the body.

There are multiple nervous system functions provided by the vagus nerve and its related parts. The vagus nerve functions contribute to the autonomic nervous system, which consists of the parasympathetic and sympathetic parts

The vagus nerve has a number of different functions. The four key functions of the vagus nerve are:

-Sensory: From the throat, heart, lungs, and abdomen.

-Special sensory: Provides taste sensation behind the tongue.

-Motor: Provides movement functions for the muscles in the neck responsible for swallowing and speech.

-Parasympathetic: Responsible for the digestive tract, respiration, and heart rate functioning.

7 0
4 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
What best describes these two molecules?
Katena32 [7]

they are both structural and geometric isomers

4 0
3 years ago
Read 2 more answers
Other questions:
  • A tall green pea plant (TTGg) is crossed with a tall green pea planr
    8·1 answer
  • Which is the correct alignment for a solar eclipse?
    7·2 answers
  • How do y'all deal with stress?
    13·2 answers
  • Hummingbirds drink nectar from flowers. Your teacher has asked you to make a model of a flower that would attract a numu.
    9·1 answer
  • What is the purpose of the cell membrane?
    9·1 answer
  • DNA polymerase has multiple mechanisms for editing and error correction, whereas the capacity for error correction in RNA polyme
    13·1 answer
  • Help me please<br> If you help me you get brainliest answer and 20 points!!!!!!
    6·2 answers
  • Carrying the genetic code and determining an organism's structure and function are the functions of
    5·1 answer
  • Organisms that are similar in structure and form and successfully reproduce among
    9·1 answer
  • Please help!!!
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!