1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sphinxa [80]
4 years ago
10

What is the name of the process whereby a platform with many wells is secured to the ocean floor?

Biology
1 answer:
Andru [333]4 years ago
4 0

Answer:

Option A, Offshore Drilling

Explanation:

In the process of offshore drilling, oil is extracted from the wells which are located at the surface of ocean floor.

Different types of oil rigs are used for oil extraction depending on the depth of the ocean.  

It is a good mode of extracting oil from sources that have remained untapped since long. With the new technology, several nations have been able to explore this oil reserve and have become independent in terms of energy

Hence, option A is correct

You might be interested in
Mistletoe extracts water and nutrients from the spruce to the spruce tree's detriment.
serg [7]

Answer:

B

Explanation:

3 0
3 years ago
Why is a punnett square used in genetics?
vaieri [72.5K]
The Punnett square is a diagram used to predict the result of a breeding experiment through analysing predictable traits which will be passed on genetically by each organism. This diagram helps to identify the probability of an offspring having specific genotypes and characteristics after the breeding process. This is determined by placing the parent genotypes into the diagram and crossing them. 
6 0
3 years ago
Read 2 more answers
Why will these changes make it more difficult for the plants to grow
frutty [35]

Explanation:

In contrast to a popular conservative argument, a new study has found that increased atmospheric carbon dioxide isn’t necessarily a boon to plant growth — instead, it causes plants to have a more difficult time absorbing nitrogen, a nutrient critical to plant growth and health.

Published in the journal Global Change Biology, the study found that as carbon dioxide levels in the air increase, the concentration of nitrogen in plants decreases, thus decreasing the plant’s protein levels and growth ability. The team of international researchers studied the impact of increased atmospheric carbon across multiple types of ecosystems — from grasslands for forests — by looking at large-scale field experiments conducted in eight countries across four different continents.

“For all types of ecosystem the results show that high carbon dioxide levels can impede plants’ ability to absorb nitrogen and that this negative effect is partly why raised carbon dioxide has a marginal or non-existent effect on growth in many ecosystems,” Johan Wedding, senior lecturer at the Department of Biological and Environmental Sciences at the University of Gothenburg and lead researcher on the project, said in a press statement.

Among conservatives — and some scientists — there has been a long-held hope that climate change could actually stimulate plant growth in the short term, as the atmosphere becomes richer with carbon dioxide. Sen. James Inhofe (R-OK) has said that climate change has “contributed to increasing agricultural productivity,” arguing that “CO2 is a fertilizer.” And while some studies have supported Inhofe’s claim, others — like this most recent one — have found the opposite to be true.

“The findings of the study are unequivocal. The nitrogen content in the crops is reduced in atmospheres with raised carbon dioxide levels in all three ecosystem types. Furthermore, we can see that this negative effect exists regardless of whether or not the plants’ growth increases, and even if fertilizer is added. This is unexpected and new,” Wedding said.

The study found that for both wheat and rice, increased carbon dioxide in the atmosphere led to less nutritious crops. Wheat and rice are two of the most important crops globally — alongside maize, wheat and rice provide over 50 percent of the world’s plant-derived energy, according to the International Development Research Center.

Past studies have also seen reductions in nitrogen content for plants grown in a high-carbon environment, but have traditionally attributed it to a kind of dilution — the idea being that as carbon stimulates plant growth and the rate of photosynthesis increases, nitrogen uptake simply wasn’t able to keep up. That theory, Wedding said, has now been called into question.

“The findings of this study show that this interpretation is simplified and partly incorrect. We are seeing reduced nitrogen content even when growth has not been affected. Moreover, the effect is there in trials with powerful fertilizer, which indicates that it is not down to limited access to nitrogen in the soil,” Wedding said. “Future studies should look at what is causing the effect, but it appears to be linked to plants’ capacity to absorb nitrogen rather than to changed levels in the soil

3 0
3 years ago
Read 2 more answers
Which areas of South America are more likely to experience hot and dry conditions
azamat
They range from the dry desert conditions of northern Chile to the heavy rains along the windswept southwestern coast of the continent
4 0
3 years ago
Read 2 more answers
What is a "start codon"? What is the nitrogen base sequence for the start codon?
ioda
The start codon is the first codon of a messenger RNA (mRNA) transcript translated by a ribosome.

Nitrogen base sequence for the start codon is AUG.
5 0
3 years ago
Other questions:
  • Which part of the plant cell performs photosynthesis ??
    13·2 answers
  • Which of the following statements is true according to the Fluid Mosaic model of the cell membrane? The lipid bilayer is sandwic
    8·1 answer
  • What is the valve that controls the entrance to the stomach and prevents backflow to the esophagus?
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Just like actual fingerprints, DNA fingerprints are unique to most individuals (other than identical twins). Today, most police
    12·1 answer
  • 1. Which of the following is NOT a reason to consider when selecting the location of
    14·2 answers
  • Over the last several decades, the scientific community has gathered a large amount of
    8·2 answers
  • After a complimentary mRNA strand of a gene is copied, the _______ regions must be removed using a(n) __________ because these r
    5·1 answer
  • what happens during translation? a.) messenger RNA is made from a DNA code. b.) the cell uses a messenger RNA code to make prote
    6·1 answer
  • Which structures group together to form tissues?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!