1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cricket20 [7]
2 years ago
10

An igneous rock that contains mostly plagioclase feldspar and about 30 percent dark silicate minerals has a composition that is

_____.
Biology
1 answer:
frosja888 [35]2 years ago
4 0

Answer:

The given blank can be filled with andesitic.

Explanation:

An extrusive igneous, volcanic rock, of the composition that comes in between the texture of aphanitic and porphyritic, is known as andesite. Generally, it is the transitional type between rhyolite and basalt. The arrangement of the mineral is generally dominated by plagioclase in addition with other dark silicate minerals.

You might be interested in
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
2. Identify Chemical Changes (check all that apply)
I am Lyosha [343]
Changes in the state of matter A, bubbling or fizzing B, and changes in volume F
4 0
3 years ago
What is the importance of the phosphorus cycle??
dimulka [17.4K]

Phosphorus is an essential nutrient for plants and animals. Phosphorus is a limiting nutrient for aquatic organisms. Phosphorus forms parts of important life-sustaining molecules that are very common in the biosphere.


5 0
3 years ago
Please help, will give brainliest ​
WARRIOR [948]

Answer:

contraction and relaxation of the heart

Explanation:

8 0
3 years ago
Please help me. I will give 30 points for each good answer. Actually make that 40 points. I really need help, this quiz is timed
Marina CMI [18]

Answer: C

Explanation: Early settlers used sheep for their meat, milk, and wool

3 0
2 years ago
Read 2 more answers
Other questions:
  • What happens to the dirt and matrix from each grid? it is discarded as trash it is burned to avoid contamination of the site it
    10·1 answer
  • What is a consequence of the specific heat capacity for liquid water, ice and water vapor
    8·1 answer
  • Cameron is collecting data to determine the time of completion for each stage of germination in seeds. He is using bean seeds fo
    10·1 answer
  • When cells perform cellular respiration, they produce a molecule known as ATP (adenosine triphosphate). How does the cell use AT
    6·2 answers
  • Which statements describe the pyrimidines in DNA?
    7·1 answer
  • What is true of the parents of an organism with the genotype, aa?
    11·1 answer
  • The following is a list of events involved in the activation of a cell by a steroid hormone. Which one of the following answers
    8·1 answer
  • 6. Endocrine glands ________. a. secrete hormones that travel through a duct to the target organs b. release neurotransmitters i
    15·1 answer
  • Complementary strand of DNA?<br> DNA Strand 1: AATCGGTAC
    7·1 answer
  • In a monohybrid cross, if the gene for tall (T) plants was incompletely dominant over the gene for short (t) plants, what would
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!