1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IRINA_888 [86]
3 years ago
6

Much of what scientist know about Australopithecines comes from the Lucy skeleton true or false?

Biology
1 answer:
adoni [48]3 years ago
3 0
The correct answer is true.
You might be interested in
(ASAP)
Anni [7]

Answer:

A.The strong nuclear force attracts and binds protons and makes the nucleus unstable.

Explanation:

5 0
3 years ago
Read 2 more answers
Element Q is an element that has a metallic shininess, has good heat conductivity, and is very brittle. To which of the followin
vovangra [49]

Answer:

C. metals

Explanation:

Elements in the periodic table are grouped into metal and non-metals depending on their characteristics. Metals usually possess the following characteristics:

- High melting and boiling point

- Brittle i.e. ability to break

- lustre i.e. ability to shine when polished.

- Good conductor of heat and electricity

Based on this above characteristics, element Q in this question is a METAL because it posseses the same qualities that a metal does.

6 0
3 years ago
Coyotes and dogs have been placed into different species. however, they can mate and produce viable, fertile offspring. what wou
Ostrovityanka [42]
That fact can be explained by the similarity in their genes. 

Dogs and coyotes are from the same class, family and genus (Mammalia, Canidae, Canis).
This is almost enough for their offspring to be viable. But if the DNA is similar (which it is) offspring the chances of viable and fertile offspring is high almost at 100%.

Hope it helped,

Happy homework/ study/ exam!
8 0
3 years ago
Ayuden ahora porfa ❤️❤️❤️
Ostrovityanka [42]

Answer:

creo que es la D

Explanation:

6 0
3 years ago
Bill the gardener plants snapdragons each year. Last year he planted white snapdragons and red snapdragons. He then collected th
omeli [17]

Answer:

Incomplete dominance

Explanation:

Incomplete dominance is a condition observed in the organisms while studying their genetics.

When the organisms with two alleles for the same trait are crossed, then neither of the two alleles completely express themselves but a new variation of the trait is formed.

This can be observed in the given scenario also when the ed and white flowers are crossed, then the pink flowers (a new variation of the trait) is formed called blended trait.

Thus, incomplete dominance is correct.

7 0
3 years ago
Other questions:
  • Yellow Longnose Butterflyfish is edible for humans?
    9·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The heart is part of the cardiovascular system and is made of cardiac muscle. Cardiac muscle has special characteristics that di
    15·2 answers
  • How do the lungs and heart work together?
    10·2 answers
  • Which species member would be unlikely to pass the gene mutation on to its offspring
    14·1 answer
  • In a field of sunflowers, there are varying heights. A plant breeder is determined to breed out all of the extremely tall and ex
    13·1 answer
  • Which of the following statements about using geothermal energy is not true?
    8·2 answers
  • 3. What is "Vocal Agility"?
    6·1 answer
  • Why children should not be forced to choose site in a divorce situation ​
    14·1 answer
  • Eukaryotes that reproduce through reproduction require two cells to contribute genetic material for the production of the next g
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!