1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AlladinOne [14]
3 years ago
7

During strenuous exercise, anaerobic conditions can result if the cardiovascular system cannot supply oxygen fast enough to meet

the demands of muscle cells. Assume that a muscle cell’s demand for ATP under anaerobic conditions remains the same as it was under aerobic conditions. What would happen to the cell’s rate of glucose utilization? View Available Hint(s) What would happen to the cell’s rate of glucose utilization? Glucose utilization would increase a lot. Glucose utilization would increase a little. Glucose utilization would remain the same. Glucose utilization would decrease a little. Glucose utilization would decrease a lot.
Biology
1 answer:
svet-max [94.6K]3 years ago
3 0

Answer: glucose utilization would increase a little in proportional to that required by a body to make ATP as a result of low oxygen supply

You might be interested in
In what process do bacteria break nitrogen gas down into a usable form for plants?
Serggg [28]

During nitrogen fixation, bacteria breaks nitrogen gasses down into a usable form for plants.

6 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
The hormone that does the opposite of calcitonin is
miskamm [114]
The hormone calcitonin, which is produced by the parafollicular or C cells of the thyroid, has the opposite effect on blood calcium levels as does PTH. I hope this helps! : )
4 0
3 years ago
Read 2 more answers
Según la historia evolutiva y sus diferentes saltos, ¿Qué linaje de especies es más antiguo?
Arturiano [62]

es la A

Hace aproximadamente 250 millones de años ocurrió la extinción masiva del Pérmico-Triásico, un evento en el cual murieron hasta el 96 por ciento de las especies marinas y un porcentaje similar de las terrestres. Cerca de tres millones de años después se produjo la separación, a partir de un ancestro en común, de los linajes que con el tiempo darían origen a las aves y los cocodrilos. El grupo que incluye tanto a cocodrilos como aves se lo denomina Archosauria, que significa ‘reptiles dominantes’.

espero y te ayude

6 0
3 years ago
A student recorded the height of each student in the school. She then made a bar graph of her results. She observed
eimsori [14]

Answer:

Height is affected by multiple pairs of genes on different chromosomes.

Explanation:  

The quantitative traits are those whose inheritance pattern is the result of the action of multiple genes that act together with the environment. The distribution of quantitative traits in the population follows a bell-shaped curve, which is referred to as normal distribution or Gaussian distribution. These traits are 'quantitative' because they vary among individuals in the population to produce a continuous range of phenotypic values. Examples of quantitative traits include, among others, metabolic rate, height, and weight.

6 0
3 years ago
Other questions:
  • Which cell is the precursor to eukaryotic in evolution of the cell
    13·1 answer
  • If a patient cannot shrug the shoulders against resistance, which cranial nerve (cn) requires further evaluation?
    5·2 answers
  • Which molecule is metabolized in a cell to produce energy "currency" in the form of atp? hints which molecule is metabolized in
    12·1 answer
  • Its true to say that modern humans are, a, hominids b, hominins c, primates d, all of the above
    8·2 answers
  • What is preventing the myosin globular head from bonding to the active site of actin?
    14·1 answer
  • Most scientists classify organisms into
    8·1 answer
  • Which age structure diagram shows that the number of individuals decreases
    12·1 answer
  • A wave with a height of 10 feet and a wavelength of 20 feet has a wave base
    11·2 answers
  • Label the transverse wave below
    9·1 answer
  • Why do birds and humans have a 4 chambered heart
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!