1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
allochka39001 [22]
3 years ago
11

If Rosie continues to deposit $2.50 into the account every day for a year, what will she have when x = 136 and when x = 163?.

Mathematics
1 answer:
miskamm [114]3 years ago
3 0

If by “x = 136” you mean the 136th day of the year the answers are $340$ = 136 and $407.5 = 163.

You might be interested in
What are the solution(s) to the quadratic equation x2 – 25 = 0?
DIA [1.3K]
X= 5 and it also equals -5
7 0
3 years ago
Read 2 more answers
Sharon spent $3.45 on sunflower seeds the price of the sunflower seeds is $0.89 per pound how many pounds of sunflower seeds did
Degger [83]
3.45/0.89 --
3.876 pounds
round it how u willl :)
5 0
3 years ago
Read 2 more answers
Of fixed-rate, percentage, and triple net leases, which makes financial planning easiest for a business owner?
Shkiper50 [21]

The option that makes financial planning easiest for a business owner is: <u>A: Fixed rate.</u>

<h3>What is fixed rate?</h3>

Fixed rate can be defined as the interest rate charge on loan and does not varies or change but remain the same.

Fixed rate is of paramount as it makes financial planning easiest for a business owner based on the fact that the interest rate does not change.

Therefore the option that makes financial planning easiest for a business owner is: <u>A: Fixed rate.</u>

Learn more about fixed rate here:brainly.com/question/3636923

#SPJ1

6 0
1 year ago
What are the steps to solve?
masha68 [24]

Answer:

First, distribute the -2 to each value in the parentheses.

-2x + 4 = 10

(The 4 is positive because a negative multiplied by a negative is a positive)

Then, subtract 4 from both sides to get rid of it.

-2x = 6

Divide by -2 to get x by itself

x = -3

5 0
3 years ago
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
sdas [7]

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

tyr - arg - leu - leu - leu - arg - <u>ala</u> - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

7 0
3 years ago
Other questions:
  • The cost of 5 books is 71$ . What is the cost of each book
    7·2 answers
  • Complete the inequalities by
    14·1 answer
  • A student used his place value chart to show a number. After the teacher instructed him to divide his number by 100,the chart sh
    15·2 answers
  • F(x)=x^2-2x-7 <br> given the polynomial function find f(-5)
    15·1 answer
  • What is 4 hours 45 mins after 4:25 a.m.
    6·2 answers
  • F(x)=5x-3<br> f(5)=????<br> Please give me the answer
    10·2 answers
  • Find the simple interest if the loan amount is $390 at a rate of 3% for 18 months.
    7·1 answer
  • Here is a list of numbers: <br> 19, 4, -13, -17, -2, -14, 20, 8, 6 <br> State the median.
    5·1 answer
  • What is the solution to this system of equations? ​
    13·1 answer
  • Which rational functions have an oblique asymptote? Check all that apply. f(x) = x^2+1/x f(x)= 4x^2-6/x+1 f(x)=-x/x^2 f(x)=x^5/x
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!