1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ne4ueva [31]
3 years ago
5

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mathematics
1 answer:
sdas [7]3 years ago
7 0

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

tyr - arg - leu - leu - leu - arg - <u>ala</u> - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

You might be interested in
Find the square root of the following number by prime factorization: 65536
Vikki [24]

Answer:

256

Step-by-step explanation:

256 X 256 = 65536

7 0
3 years ago
A farmer of a large apple orchard would like to estimate the true mean number of suitable apples produced per
katrin [286]

Answer:

Sampling variation

Step-by-step explanation: took the quiz

5 0
3 years ago
X + 4 = 3x + 2.<br> Help with answer
Len [333]

Answer:

x=1

Step-by-step explanation:

1+4=5

3x1+2=5

8 0
3 years ago
Read 2 more answers
What would the answer be ?
Mashutka [201]

Answer: 7

Step-by-step explanation: there are 4 full circles so that equals 4. 1+1=2, 1/8+7/8=1. 4+2+1=7

6 0
2 years ago
Read 2 more answers
I need it to answer for my assignment plz
Inessa [10]

Answer:

Step-by-step explanation:

The monthly rents paid by the 10 people are

845, 875, 890,900,960, 965, 990, 1015, 1045, 1065.

The mean rent is determined by

Sum of rent paid/ total number of people that paid rent.

Mean = (845+875+890+900+960+965+990+1015+1045+1065) /10 = 9550/10 = 955

Median = (960+965)/2 =1925/2 = 962.5

Suppose that one of the people moves, her rent changes from 1065 to 915, the mean becomes

(845+875+890+900+ 915 + 960+965+990+1015+1045)/10 =9400/10 = 940

The median is (915 +960)/2 =1875/2 = 937.5

Therefore,

a) the mean decreases by

955 - 940 = 15

b) the median decreases by

962.5 - 937.5= 25

8 0
4 years ago
Other questions:
  • You are sending your friend a coded message by rearranging the letters in the word “STRIKE.” That is, your code can be any arran
    12·2 answers
  • A pitcher of water contains 1/4 of water. The water is poured equally into 5 glasses. How many liters of water are in each glass
    5·2 answers
  • A 12% discount on a tent saved melanie $75 what was the original price
    14·1 answer
  • Find c such that (−3,−8), (−7,−6), and (c,4) lie on a line.
    14·1 answer
  • Help me plsss ill give ten pointsssss
    13·2 answers
  • One inch is approximately 2.54 centimeters. Find the length to the nearest hundredth of a centimeter of a plant that is 12.5 inc
    11·1 answer
  • What is the numerical Absolute values of -16
    15·1 answer
  • Which equation correctly shows the angle relationships for the given figure? -- A) (3x - 14)° - 9x° = 180° - B) (3x - 14)° + 9x
    14·1 answer
  • It took Thomas 25 minutes longer to do his math homework than I do is French homework. He spent a total of 2.25 hours on the sub
    9·1 answer
  • Help me quickly please, im not good at this kind of math.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!