1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ne4ueva [31]
3 years ago
5

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mathematics
1 answer:
sdas [7]3 years ago
7 0

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

tyr - arg - leu - leu - leu - arg - <u>ala</u> - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

You might be interested in
Seriously need help with this question or I will fail my senior year
nlexa [21]

Answer:

you cheater

Step-by-step explanation:

Tring to cheat because you don't feel like doing it. Hopefully you fail so you can learn your lesson

5 0
3 years ago
Read 2 more answers
What number does this Roman numeral represent?<br><br> DCCLXXXI
avanturin [10]

k there is your answer. be happy. UwU

7 0
4 years ago
Read 2 more answers
What is the sum of 3 + (-4) ?
andreev551 [17]

Answer:-1

Step-by-step explanation:3-4=-1

5 0
3 years ago
Read 2 more answers
22 gallons of gas cost $65.56. What is the unit rate for 1 gallon of gas?
alekssr [168]
<span>divide 65.56/22= 2.98 per gallon. </span>
6 0
3 years ago
Read 2 more answers
Write the number of lines of symmetry in each letter of the word MATHEMATICS
11111nata11111 [884]

Answer:

Letter 'S'

Step-by-step explanation:

in the word 'MATHEATICS' has no line symmetry.

8 0
2 years ago
Read 2 more answers
Other questions:
  • Daniel brought 2.75 pounds of Spanish fried rice to a family dinner. During the meal, Daniel and his family ate 1.25 pounds of r
    7·1 answer
  • 150 ÷17 for fifth graders
    6·1 answer
  • A fish tank at an aquarium has a volume of​ 1,568 cubic feet and a depth of 8 feet. If the base of the tank is​ square, what is
    5·1 answer
  • M : _____ <br> b : _____<br> Equation : ______ <br><br><br> PLEASE HELP ME !!!
    14·1 answer
  • PLS ANSWER THIS TEST IS SOO HARD FOR ME
    9·1 answer
  • Answer?need helpbwith this
    13·1 answer
  • Pls answer 2x+1=7 it would really help
    6·2 answers
  • In a survey, 16% of male college students said they lie sometimes to get a woman to go out on a date with them. If a male colleg
    13·1 answer
  • Find the roots 5x^2+16=7x^2/3
    13·1 answer
  • Which mixed number is equivalent to the improper fraction 42/5
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!