1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ne4ueva [31]
2 years ago
5

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mathematics
1 answer:
sdas [7]2 years ago
7 0

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

tyr - arg - leu - leu - leu - arg - <u>ala</u> - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

You might be interested in
Algebra 2 question need help.​
MrMuchimi

Answer: Choice C

h(x) = -x^4 + 2x^3 + 3x^2 + 4x + 5

===========================================

Explanation:

When reflecting the function f(x) over the y axis, we replace every x with -x and simplify like so

f(x) = -x^4 - 2x^3 + 3x^2 - 4x + 5

f(-x) = -(-x)^4 - 2(-x)^3 + 3(-x)^2 - 4(-x) + 5

f(-x) = -x^4 + 2x^3 + 3x^2 + 4x + 5

h(x) = -x^4 + 2x^3 + 3x^2 + 4x + 5

Note the sign changes that occur for the terms that have odd exponents (the terms -2x^3 and -4x become +2x^3 and +4x); while the even exponent terms keep the same sign.

The reason why we replace every x with -x is because of the examples mentioned below

-----------

Examples:

The point (1,2) moves to (-1,2) after a y axis reflection

Similarly, (-5,7) moves to (5,7) after a y axis reflection.

As you can see, the y coordinate stays the same but the x coordinate flips in sign from negative to positive or vice versa. This is the direct reason for the replacement of every x with -x.

4 0
2 years ago
A scuba diver reaches an elevation of -78 feet, which is a depth of 78 feet.
gavmur [86]

Answer:

true

Step-by-step explanation:

depth is how far down you are from the surface

6 0
3 years ago
The experimental probability that Amir will make a basket is 0.4. The experimental probability that Juju will make a basket is 0
madreJ [45]

Answer:

30 baskets

Step-by-step explanation:

The experimental probability Pa that Amir will make a basket is 0.4;

Pa = 0.4

the experimental probability Pj that juju with make the same basket is 0.6;

Pj = 0.6

Total number of shoot Nt = 150

Number of basket Amir will make is;

Na = Pa × Nt

Na = 0.4 × 150

Na = 60 basket

Number of basket juju will make is;

Nj = Pj × Nt

Nj = 0.6 × 150

Nj = 90 basket

6 0
2 years ago
Read 2 more answers
What is the literal surface area of triangular prism above
natulia [17]
36 it the surface area of the triangler prism
5 0
2 years ago
There was 2/3 of pan of lasagna in the refrigerator. Bill and his friends ate half of what was left. Write a number sentence and
Veseljchak [2.6K]
Half of 2/3 is:

\frac { 1 }{ 2 } \times \frac { 2 }{ 3 } =\frac { 1 }{ 3 }

This means that 1/3 was left. This also means that they ate 1/3 of the lasagne.

Model diagram can be seen in attachment.

5 0
3 years ago
Other questions:
  • A variety of two types of snack packs are delivered to a store. The box plots compare the number of calories in each snack pack
    15·2 answers
  • Please help me please!!!!!!!!
    11·2 answers
  • What is negative eight plus four​
    12·2 answers
  • A restaurant bill comes to 39.24 fine the total when tax is 7% and tip is 15%
    13·1 answer
  • Throughout the 2016 Presidential election primaries, Millennials (those aged 20 t 36 years) consistently supported Senator Berni
    8·1 answer
  • How do i find the area of a trapezoid (pictures provided)
    13·1 answer
  • 97. Find the value of y in the relation y = 3x2, when x = 3."<br>1 point​
    15·2 answers
  • Find the area of a circle with radius, r = 6.92m. Give your answer rounded to 2 DP.
    11·1 answer
  • While back-to-school shopping, you find two pairs of jeans that cost $29 each, three shirts that cost $16 each, and a pair of sh
    8·1 answer
  • An art class costs $45 for materials and then
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!