1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ne4ueva [31]
3 years ago
5

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mathematics
1 answer:
sdas [7]3 years ago
7 0

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

tyr - arg - leu - leu - leu - arg - <u>ala</u> - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

You might be interested in
Find the value of x.
padilas [110]
To find your missing angle:
180-126 = 54
so 9x must equal 54
54= 9x
6 = x
3 0
3 years ago
Jill is making lemonade. The original concentration was 25 mL of concentrate to 2 L of water. People found that too strong so sh
Harlamova29_29 [7]
100%= 25mls

20/25 x 100 = 80%

100%-80%= 20%
4 0
3 years ago
Read 2 more answers
What is the square root of 325 rounded to two decimal places?
hammer [34]
The square root of 325 is 18.03
7 0
4 years ago
Each year a store decreased the price of certain model of TV by $35.If the price in 2001 was $1,950,what was the price in 2009?
Vanyuwa [196]
The answer is 1,670 because you have to multiply 35*8 which equals 280 and subtract it from 1950, and you get 1,670.
7 0
4 years ago
A storm moves at a rate of 8 miles per hour. It is 200 miles away from Freeport and headed directly for this town. The equation
Eduardwww [97]

Pls see answer below.

Step-by-step explanation:

In this case, our slope is -8. This means that every hour, the storm is getting closer to the town by 8 miles per hour.

Our y-intercept is 200, which means that its' initial position is 200 miles away from the town.

Hope this helped.

7 0
3 years ago
Other questions:
  • The average wind speed at a local weather station is 34.8 miles per hour. The highest speed ever recorded the stations 318.0 mil
    9·1 answer
  • The length of a standard jewel case is 7cm more than its width. The area of the rectangular top of the case is 294 cm^2. Find th
    8·1 answer
  • Write (picture included) as a complex number in standard form.
    15·1 answer
  • What plus what equals a half
    8·1 answer
  • You earn 360 dollars every 4 weeks how much money do you make in one week
    6·2 answers
  • Which correctly Applies the distributaries property to show an equivalent expression to (-2.1)(3.4)
    8·1 answer
  • A couple plans to have 3 children. Assuming the probability of having either a boy or a girl is 50%, what is the probability the
    8·1 answer
  • A middle school took all of its 6th grade students on a field trip to see a symphony at
    15·1 answer
  • Need Help! (No links)
    5·1 answer
  • Please answer this question
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!