1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ne4ueva [31]
2 years ago
5

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'

Mathematics
1 answer:
sdas [7]2 years ago
7 0

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

tyr - arg - leu - leu - leu - arg - <u>ala</u> - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

You might be interested in
A fair rents a thrill ride for $3000. It cost $4 to purchase a token for the ride. Write and solve an inequality to determine th
maria [59]

Answer:

938

Step-by-step explanation:

Given that :

Amount spent by fair on thrill. Ride = $3000

Cost per token of thrill ride = $4

For the fair to make a profit of atleast $750

Then it must realize : (cost of thrill ride + $750) = ($3000 + $750) = $3750

Therefore ;

Cost per token * number of rise tokens ≥ $3750

Let number of ride tokens = x

4x ≥ 3750

4x/4 ≥ 3750/4

x ≥ 937.5

Hence, number of tokens that must be sold = 938

4 0
2 years ago
Set of multiples of 3 less than 15?​
geniusboy [140]

Answer:

3,6,9,12,15

Step-by-step explanation:

5 0
2 years ago
The diagram shows a right-angled triangle.
Karo-lina-s [1.5K]

Answer:

sorry j don't have my calculator but

sine of angle x°=opposite 6cm/9cm

byee

8 0
2 years ago
Read 2 more answers
How many solutions does this linear system have?<br> Y=2x-5<br> -8-4y=-20
nataly862011 [7]
The answer is 3.Good luck
8 0
3 years ago
Read 2 more answers
Diana can type 100 form letters
satela [25.4K]

Answer:

it will take 3 hours long

8 0
2 years ago
Other questions:
  • I need help with this question
    6·1 answer
  • The volume of a sphere whose diameter is 18 centimeters is π cubic centimeters. If its diameter were reduced by half, its volume
    11·1 answer
  • What is the solution of the system? {2x+y=15x−y=3 Enter your answer in the boxes.
    9·2 answers
  • How much would homeowners insurance for $100,00
    12·1 answer
  • I need help fast pleasee
    6·1 answer
  • a playing card is chosen at random from a standard deck of cards. what is the probability of choosing 5 of diamonds or one jack
    9·1 answer
  • I need help ASAP pls help !!
    14·1 answer
  • There are 8,000 books in a library. There are 5,920 non-fiction books. What percent of the books are non–fiction books?
    8·1 answer
  • Will give bainlyest!
    5·2 answers
  • Simplify (3x − 5) (5x 1). 8x − 6 8x 4 8x − 4 2x − 4.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!