All categories

3 years ago

Why haven’t more regulations been put in place for agriculture in terms of water pollution?

Biology

2 answers:

telo118 [61]3 years ago

7 0

Answer:

The rules and laws for the farmers for doing agriculture and prevent water pollution are less because the regulatory laws if followed by the farmers will make impossible for farming and trap them in a low-income and productivity of the crops.

Explanation:

sattari [20]3 years ago

6 0

Answer:

The rules and laws for the farmers for doing agriculture and prevent water pollution are less because the regulatory laws if followed by the farmers will make impossible for farming and trap them in a low-income and productivity of the crops.

Explanation:

Agriculture leads to water pollution due to the excessive use of chemical fertilizers and pesticides. These chemicals seeps from the soil to the water bodies thereby causing water pollution. Water pollution is harmful for the aquatic plants and animals and also affects human health.

There are rules and laws for the farmers for doing agriculture and prevent water pollution but they are less because the regulatory laws if followed by the farmers will make impossible for farming and trap of the crops.

You might be interested in

Third, SNP array is considered as low to moderate costs of per sample, despite the significant decrease in costs associated with

Alenkasestr [34]

Development and Applications of a High Throughput Genotyping Tool for Polyploid Crops: Single Nucleotide Polymorphism (SNP) Array.

Polypoid species play significant roles in agriculture and food production. Many crop species are polyploid, such as potato, wheat, strawberry, and sugarcane.

Genotyping has been a daunting task for genetic studies of polyploid crops, which lags far behind the diploid crop species.

Single nucleotide polymorphism (SNP) array is considered to be one of, high-throughput, relatively cost-efficient and automated genotyping approaches.

However, there are significant challenges for SNP identification in complex, polyploid genomes, which has seriously slowed SNP discovery and array development in polyploid species.

Ploidy is a significant factor impacting SNP qualities and validation rates of SNP markers in SNP arrays, which has been proven to be a very important tool for genetic studies and molecular breeding.

This review presents a complete overview of SNP array development and applications in polypoid crops, which will benefit the research in molecular breeding and genetics of crops with complex genomes.

To learn more about Single Nucleotide Polymorphism: brainly.com/question/7882029

#SPJ4

3 0

1 year ago

What are the products of photosynthesis?

musickatia [10]

Answer:

Photosynthesis converts carbon dioxide and water into oxygen and glucose. Glucose is used as food by the plant and oxygen is a by-product.

7 0

2 years ago

How is the number of species in an ecosystem related to succession?

professor190 [17]

The more advance the community the more complex the speciess

5 0

3 years ago

Scientists are interested in determining if selenium, from a nearby mine, magnifies in the tissues of fish living in a lake. Whi

kykrilka [37]

Answer:

The answer is A.

Explanation:

To test if the selenium from the mine has an effect on the fish living in the lake which i assume is close to the mine, testing the tissue of the fish from that lake and comparing it to the selenium levels of the fish from a nearby lake would be a testable hypothesis because there is a comparable aspect and there should be a difference in the numbers between the fish from the two lakes because of their distance to the mine.

I hope this answer helps.

7 0

3 years ago

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

3 years ago