1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
weeeeeb [17]
3 years ago
9

Charlie is a 14-year-old boy who has been diagnosed with rhabdomyosarcoma, a cancer of the soft tissue that has manifested as a

tumor in the orbit of his left eye (the area around his eye). He is considered stage I, because it is located in what is assessed as a "favorable area" and hasn’t metastasized to distant parts of his body.
Health
1 answer:
NemiM [27]3 years ago
3 0

True, the stage of rhabdomyosarcoma in the case of Charlie is stage 1.

Explanation:

Rhabdomyosarcoma a common malignant tumor affecting children.  

Based on the TNM (tumor, nodes, metastasis) classification of tumor stages, rhabdomyosarcoma is said to be in stage 1 if the tumor has started or located at a favorable site like,  

  1. The eye orbital area
  2. The head and neck area  
  3. A genitourinary site
  4. Bile ducts

At this stage, the size of the tumor can vary. It can grow and spread or metastasize to nearby areas but cannot to distant areas.

You might be interested in
What energy is nuclear fission?
alisha [4.7K]

Answer:

In nuclear fission, atoms are split apart, which releases energy. All nuclear power plants use nuclear fission, and most nuclear power plants use uranium atoms. During nuclear fission, a neutron collides with a uranium atom and splits it, releasing a large amount of energy in the form of heat and radiation.

Explanation:

3 0
4 years ago
Read 2 more answers
How to prevent gestational diabetes during pregnancy?.
sashaice [31]

Answer:

Have a balanced diet

Eat healthy and nutritious food

Add exercises in your daily routine

Try to lose excess weight before pregnancy

Explanation:

8 0
2 years ago
What are four types of medicines used to manage chronic conditions ?
MatroZZZ [7]

Answer:

Antibiotics, antitoxins, antivirals, and antifungals fight pathogens

Explanation:

8 0
3 years ago
Select the correct text in the passage.
aleksley [76]

Answer:

I the answer is NOAA is working at Atlantic ocean

4 0
3 years ago
A method for assessing your body size by taking your height and weight into account is the
g100num [7]
<span>Body mass index (BMI).</span>
5 0
4 years ago
Read 2 more answers
Other questions:
  • I ovulated two days ago why is my opk test showing positive still
    10·1 answer
  • The best way to reduce risk in icy conditions is to
    14·1 answer
  • Which of the following reasons are helpful in educating patients on the importance of ergonomics in patient care?
    7·1 answer
  • What does it mean that an organism must maintain homeostasis\?
    15·1 answer
  • Julia just learned that her little sister stuck her hairbrush in cat litter. She begins to yell at her sister in frustration. Th
    10·1 answer
  • An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
    12·1 answer
  • My 7 year old has two burns on his finger from touching a hot light how can i take his pain away
    6·1 answer
  • En que consiste la forma farmaceutica oral
    15·1 answer
  • Hey I just wanted to say that for all of you that have veteran family or have lost veteran family that they are appreciated by m
    11·1 answer
  • 8. It's vital to consider your life choices and to avoid
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!