Answer;
- radiometric dating of rocks
- fossil evidence
- gradual processes of rock
Explanation;
Radiometric dating confirms that Earth is ancient and explains how extremely slow processes can result in major changes to Earth’s surface. Evidence from radiometric dating indicates that Earth is about 4.54 billion years old. The geology or deep time of Earth's past has been organized into various units according to events which took place.
-The ages of Earth, Moon, and meteorites, radiometric dating has been used to determine ages of fossils, including early man, timing of glaciations, ages of mineral deposits, recurrence rates of earthquakes and volcanic eruptions, the history of reversals of Earth's magnetic field, and the age and duration of a wide variety of other geological events and processes.
The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to produce proteins is called translation.
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
Answer:
Some fungi help trees and other plants to grow. Because the fine threads that make fungal mycelium can spread over long distances, fungi can capture water and nutrients from far away and bring them back along the fine threads and close to plant roots.
Can you make me Brainliest Answer please?
Explanation:
Answer:
C) gills
Explanation:
becausethe tadpoles starts to lose its gills and develop teeth. Soon after this their back legs develop, their diet changes and they become carnivorous
