1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bogdan [553]
3 years ago
11

What will happen when the membrane and transporting substance meet?

Biology
2 answers:
horrorfan [7]3 years ago
7 0
The structure of the lipid bilayer allows small, uncharged substances such as oxygen and carbon dioxide, and hydrophobic molecules such as lipids, to pass through the cell membrane, down their concentration gradient, by simple diffusion.
sergey [27]3 years ago
3 0

Answer:

Water passes through the membrane in a diffusion process called osmosis. During active transport, energy is expended to assist material movement across the membrane in a direction against their concentration gradient. Active transport may take place with the help of protein pumps or through the use of vesicles.

Explanation:

You might be interested in
which one of the statements describes an event that takes place during gene regulation at the level of the chromosome?
NISA [10]
Chromatin is remodeled and nucleosomes are repositioned, thereby making specific regions of the DNA available for transcription
8 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
The purpose of transcription is to create
Levart [38]

Answer:

B. a sequence of DNA bases that duplicates a sequence of RNA bases.

Explanation:

Transcription is the first step in gene expression. It involves copying a gene's DNA sequence to make an RNA molecule.

4 0
3 years ago
4. In an experiment, suppose that the wings of fruit flies were clipped short for fifty generations. The fifty-first generation
Akimi4 [234]
The observation from the first question would tend to disprove the idea that evolution is based on b. inheritance of acquired characteristics because according to the experiment  <span>theory of <span>adaptation was taken as a basis.
The answer for the next question is definitely adaptation as at first every live -being should get used to its environment in order to develop and so on.</span></span>
6 0
3 years ago
What is the difference between a species and a population?
adelina 88 [10]
Going back to naming and classifying all of the living organisms, let us take a look at what can be the difference between<span> a specie and </span>population<span>. ... It is defined as the organisms capable of sexual intercourse and producing offspring which are fertile and able to produce as well

</span>
8 0
3 years ago
Other questions:
  • adenine, guanine, cytosine, and thymine are the four nitrogenous bases present in the dna of all organisms. which scientist disc
    5·2 answers
  • A plant leaf is he is an organ that traps light energy to make food in what way is an animal stomach similar to a plant leaf
    7·1 answer
  • Over the past century, several scientists around the world have made the following observations:
    9·1 answer
  • Which is moved across a cell membrane through the process of facilitated diffusion?
    5·1 answer
  • Describe how H. Habilis might have lived
    5·1 answer
  • What micromolecule is produced during photosynthesis for plant food?
    11·2 answers
  • What is intramembranous ossification? a. the formation of bone from preexisting hyaline cartilage models b. the formation of bon
    14·1 answer
  • Brown eyes in humans is a dominant trait. we inherit dominant traits from our parents, some from our mother and some from our fa
    8·2 answers
  • Which of these is an external pest
    14·2 answers
  • I don’t understand how to do this
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!