1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkinab [10]
3 years ago
6

If both plants in the parent generation are homozygous for pea color, which of the following statements must be true? Hint: Exam

ine the F1 generation. What do you notice?
A.)Yellow alleles are dominant over green alleles.

B.)All plants in the F1 generation are homozygous for the yellow allele.

C.)Green allele is dominant over yellow for pea color.

D.)The parents both passed on the yellow allele.
Biology
1 answer:
Komok [63]3 years ago
6 0

If both plants in parent generation are homozygous for pea color, All plants in the F1 generation are homozygous for the yellow allele. The parents both passed on the yellow allele.

Explanation:

In Mendelian peas it is said the yellow colour is dominant over green colour.

If in F1 generation all alleles are dominant and homozygous for yellow colour allele. All four progeny are dominant and homozygous.

    R       R

R  RR    RR

R   RR   RR

Punnett square

both parents passed on the yellow allele.

You might be interested in
Compare the freezing point of water on the celsius and the fanhreneit temperature scales
ANEK [815]
Water freezes as 0º Celsius and 32º Fahrenheit. 
I'm not sure what more there is to compare.
5 0
3 years ago
What if the action potential never rest or not stopping? Some real-life examples of a person and what are the consequences?
vitfil [10]

Answer:

Hdnnake

Explanation:idkdkdndjnd

I’ll

4 0
3 years ago
In the western states, a dry creek is called an arroyo or _____.
Kay [80]
It can be called<span> a draw, a wash or a gulch</span>
6 0
3 years ago
Read 2 more answers
PLEASE HELP ASAP!!!! CORRECT ANSWERS ONLY PLEASE!!!!
IrinaK [193]
Lets go with 0 M....
7 0
3 years ago
Read 2 more answers
4. A friend says cells do nothing during<br> interphase. Do you agree or disagree?<br> Explain why.
valentinak56 [21]

Answer:

Disagree

Explanation:

During interphase, the cell copies its DNA in preparation for mitosis.

it spends its whole life doing this.

7 0
3 years ago
Other questions:
  • Daphnia are freshwater organisms sometimes referred to as “water fleas.” Design an experiment that
    10·2 answers
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which statement describes the relationship between plants, animals, and the carbon cycle?
    6·1 answer
  • Which of statements is/are true for sexual reproduction in plants?
    14·1 answer
  • Como é chamado no Brasil um profissional que estudou ciência política ou antropologia?
    13·1 answer
  • 3 mutations frameshift mutation how im going to remeber this meaning answer
    9·1 answer
  • Which of the following describes a relationship of predator-prey A. Oxpecker birds eat parasitic ticks off the backs of zebras B
    6·2 answers
  • Logical reasoning quiz be Lindsay Bowden
    10·1 answer
  • Gene regulation in eukaryotes is less complex than in prokaryotes<br>true or false​
    7·1 answer
  • EASY 10 POINTS<br><br> Why do plant cells need chloroplasts?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!