1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artemon [7]
3 years ago
8

Use the drop-down menus to complete the sentence

Biology
1 answer:
Lynna [10]3 years ago
8 0

Answer:

they are covered by fruit.

Explanation:

since angiosperm means covered seeds, they usually refer to the seeds that have a outer cover thats helps to protect them like fruit

extra info:

gymnosperms are known as naked seeds and they usually refer to the pines present on trees

im sorry if this wasnt any help..i tried my best

You might be interested in
Template Strand - A-T-G-C-A-T-G-T-C-A-C-C
topjm [15]

Answer:

UACGUACUGGAUGCAGUCACC

Explanation:

3 0
3 years ago
5. What are the possible blood groups of children whose parents are blood group A (heterozygous)
olga55 [171]
50% AB 25% A 25% B I think sorry if it’s wrong
4 0
3 years ago
Can someone please help me with this?
xxTIMURxx [149]

Answer:

Todd : will be circled

Because he had said the correct statement

cell is the basic structural and functional unit of life..

group of cells make tissues, group of tissue make organs and group of organs make organs system......

7 0
3 years ago
Read 2 more answers
What must you know to solve Kepler's third law, the law of periods?
m_a_m_a [10]

Answer:

I found this on google

<em>the square of the orbital period of a planet is proportional to the cube of the semi-major axis (size) of its orbit</em>

Explanation:

4 0
3 years ago
Please help.................
eimsori [14]

  <u> Y   y</u>             The Answer is 25%. Sorry About the punnett Square, it's all i                  

                        could do.

<u>Y</u>  Y  Y

<u>y</u>   Y  y

7 0
3 years ago
Other questions:
  • Soil is a mixture of
    13·1 answer
  • Plz answer I will give brainliest
    10·2 answers
  • Which type of fossil contains little or no organic material
    11·1 answer
  • A fertile hypha that bears spores is called a
    8·2 answers
  • g The net effect of the eight steps of the citric acid cycle is to ________. The net effect of the eight steps of the citric aci
    15·1 answer
  • According to the theory of plate tectonics what May form where plates move together?
    15·1 answer
  • Add the following complex numbers:
    11·1 answer
  • Radioactive Decay Energy Quick ChekWhich type of energy does alpha decay generate?(1 point) electromagnetic electromagnetic soun
    5·1 answer
  • Which statement about enzymes is true? O An enzyme functions to decrease the rate of a chemical reaction.
    15·1 answer
  • 2. How are the amino acids formed from the codon in Mutation #2 different from those
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!