1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ANEK [815]
3 years ago
15

The growth rate of a population that has a limited food supply will MOST LIKELY be

Biology
2 answers:
docker41 [41]3 years ago
8 0
The answer is probably "natural"
FrozenT [24]3 years ago
3 0
The population would most likely decline due to scarce food supply
You might be interested in
What is upwelling and why is it important to the marine ecosystem?
xxTIMURxx [149]
Upwelling is a process in which the deep and cold water rises to the water surface and not sea surface. This process plays an important role in maintaining balance in our ecosystem as it boost the marine productivity by washing the nutrients from deeper waters to the photic layer where photosynthesis is promoted.
7 0
4 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
How do the unsaturated fatty acids in phospholipids affect the structure of cell membranes?
ludmilkaskok [199]

Unsaturated fatty acids are a component of the phospholipids in cell membranes and help maintain membrane fluidity. The Phospholipids contain a variety of unsaturated fatty acids, when compressed, the “kinks” in their tails push adjacent phospholipid molecules away, that helps in maintain fluidity in the membrane. Unsaturated fatty acids have at least one double bond, creating a "kink" in the chain, the absence of double bonds decreases fluidity, making the membrane very strong and stacked tightly.

The ratio of saturated and unsaturated fatty acids determines the fluidity in the membrane at a temperature, at appropriate temperatures the phospholipids have enough kinetic energy to overcome the intermolecular forces holding the membrane together, which increases membrane fluidity.

To learn more about Unsaturated fatty acids , here

brainly.com/question/4891995

#SPJ4

4 0
2 years ago
How do plants and animal adapts to temperate deciduous ecosystems
Stells [14]
They use their resources and habitats around them to survive.
7 0
3 years ago
Suppose that the resistance between the walls of a biological cell is 7.0 × 109 Ω. (a) What is the current when the potential di
DIA [1.3K]

Answer:

Explanation:

Using Ohm's law

V ( voltage) = I (current A) × Resistance R in ohms

R = 7.0 × 10⁹Ω

V = 80 mV = 80 / 1000 = 0.08 V

0.08 V = I × 7.0 × 10⁹Ω

a) I = 0.08 V / 7.0 × 10⁹Ω = 1.142857 × 10 ⁻¹¹ A

b) quantity of charge = I × t = 1.142857 × 10 ⁻¹¹ A × 0.85 s = 9.7142857 × 10⁻¹² C

number of Na⁺ ions ( q = +e) = 9.7142857 × 10⁻¹² C / 1.6 × 10⁻¹⁹ C = 60714285.714 Na⁺ ions

7 0
3 years ago
Other questions:
  • Counting tree rings is an example of which type of dating
    8·2 answers
  • Which statement describes the offspring of the F, generation when crossing a pea plant that is true breeding for green seeds
    14·1 answer
  • What is the order in which the events listed above occur during antibody mediated immunity is
    7·1 answer
  • What is the main function of the Endoplasm Reticulum?
    12·2 answers
  • a population of chimpanzees was separated when the forest that they lived in had a section cut down and a town was built. After
    11·2 answers
  • Which is the result of using one or more of your senses to gather information
    15·2 answers
  • Explain the difference between negative growth rate and zero growth rate.​
    15·2 answers
  • The bases are paired by ____ bonds along the axis of the molecule?
    8·1 answer
  • 1. Photosynthesis takes place in structures called chloroplasts that allow a plant to make glucose and oxygen. Describe one of t
    10·1 answer
  • The common ancestors of birds and mammals were very early (stem) reptiles, which almost certainly possessed 3-chambered hearts.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!