1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
s2008m [1.1K]
3 years ago
7

Which has the most immediate effect on the progress of scientific research?

Biology
2 answers:
kondaur [170]3 years ago
8 0

Answer:

I would say c

Explanation:

every other option would require some amount of waiting for change.

vesna_86 [32]3 years ago
4 0
I hope this can help you

You might be interested in
Fill out the Alien Periodic table
Oliga [24]

Refer to the attachment for periodic table

7 0
2 years ago
What could be the reason for this
chubhunter [2.5K]
The chemicals in the plant could cause it  that is the most probable answer 
4 0
4 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
A heat wave that causes an organism to move to a cooler climate is an example of ?
alekssr [168]
It is an example of migration. Hope this helps!
3 0
3 years ago
Read 2 more answers
What are the three different ways living things consume energy and how are they labeled?
34kurt

Energy is the ability to do work. The form of energy that living things need for these processes is chemical energy, and it comes from food. Autotrophs make their own food. Heterotrophs obtain food by eating other organisms. Organisms mainly use the molecules glucose and ATP for energy.

Explanation:i hope this is correct

8 0
3 years ago
Other questions:
  • What are the TWO atoms for this?
    9·2 answers
  • What must always happen before a hypothesis can be formed
    13·1 answer
  • Which of the following organisms has a closed circulatory system?
    14·1 answer
  • When a newly formed cell enters into interphase and begins conducting metabolic functions, it is in _____.
    14·1 answer
  • What characteristics Of bacteria would enable you to know it is a prokaryotic and not an eukaryote
    12·1 answer
  • Sulfa antibiotics damage bacteria by affecting a certain bacterial enzyme. The sulfa antibiotic looks similar to a substrate nor
    7·1 answer
  • If 60 seconds are in a minute, 60 minutes in an hour, and 24 hours in a day, then 86,400 seconds are in a day. What type of reas
    11·2 answers
  • Which list shows the levels of organization of an organism in hierarchical order from left to right, from the least complex to t
    5·1 answer
  • This is for kealani57 only thx :-)
    6·1 answer
  • For an action potential to be transmitted to the next neuron, it must first be ______ at the axon hillock.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!