<span>Sodium channels close when not occupied
</span><span>Sodium ions diffuse through and enter the cell.
</span>
Then they leave the cell.
The sodium diverts in the cell layer have receptor locales for acetylcholine.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
Treest are an Investment
They beautify our surroundings, purify our air, act as sound barriers, manufacture precious oxygen, and help us save energy through their cooling shade in summer and their wind reduction in winter.
Hope its help
Answer:
here is what I know about earthquakes..
Explanation:
Learn how to prepare for an earthquake with the following safety tips. Please review our guidance on preparing for an earthquake while still protecting. Doorways are no stronger than any other part of a structure so don't rely on them for protection! Staying informed about your community's risk and response plans.
Answer: The answer would be A;electron probe X-ray microanalysis
I hope that this helps! :D