1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Paul [167]
3 years ago
7

PLEASE HELP WILL MARK BRAINLEST

Biology
1 answer:
STatiana [176]3 years ago
3 0

Answer: genetics and mutation generate some of the variety that natural selection acts on

Explanation:

You might be interested in
Does human activity have a<br> measurable effect on air<br> quality?
Lelechka [254]

Answer:

yes

overpopulation, pollution, burning fossil fuels, and deforestation. Changes like these have triggered climate change, soil erosion, poor air quality, and undrinkable water.

Explanation:

8 0
3 years ago
Read 2 more answers
What is the medical definition for edema?
Kisachek [45]
Edema is a condition of abnormally large fluid volume in the circulatory system or in tissues between the body's cells(interstitial <span>spaces).</span>
3 0
3 years ago
Paul had chicken pox when he was 5 years old. nicholas received the chicken pox vaccines. which type of immunity does each man h
GrogVix [38]

Answer:

Paul has natural active immunity, while Nicholas has artificial active immunity.

Explanation:

Natural active immunity is an immunity that occurs when an individual is exposed to a disease causing organism, gets infected, and also become immune to the disease due to the primary immune response. From the question, Paul has natural active immunity because he had chicken pox before, and the virus that causes chicken pox has interacted with his immune response, hence, making him to develop natural immunity to the disease.

Artificial active immunity is an immunity that an individual acquires when small amount of immunity to a disease is deliberately exposed to his body. Artificial active immunity is usually produced in the form of vaccinations. From the question, Nicholas has artificial active immunity because chicken pox vaccines were intentionally introduced to his body.

8 0
3 years ago
_______ is an energy carrier molecule that shuttles some of the energy from glycolysis.
shtirl [24]
NADH is an energy carrier molecule that shuttles some of the energy from glycolysis
8 0
3 years ago
Which is a physical property of milk?
torisob [31]
Liquid...............
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is true?
    13·2 answers
  • Anolis cristatellus and A. cooki are both trunk-ground anoles that live on Puerto Rico. A. cristatellus lives in a shady, forest
    15·1 answer
  • Can anyone pls help?!
    10·1 answer
  • What is the basic unit of structure and function of all living organisms​
    8·2 answers
  • How is adhesion used in the human body
    7·1 answer
  • What happens to the cell and chromosomes during mitosis
    7·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • How is sympatric speciation similar to allopathic speciation
    9·1 answer
  • In the scientific name Limulus polyphemus, what is the genus? _________ species? _______.
    9·1 answer
  • Locate and name the two cities in Europe. Also, what geographic factor explains the difference in temperature and the difference
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!