1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
photoshop1234 [79]
3 years ago
12

A ____?___ allele exhibits its phenotype when it is present on both the chromosomes.

Biology
1 answer:
faltersainse [42]3 years ago
3 0
A recessive allele is shown in the phenotype 
You might be interested in
The endosymbiotic theory states that chloroplasts and mitochondria evolved as a result of
blsea [12.9K]
A Eukaryotic cell engulfing a bacterial cell.

You may want to know that the bacteria which used to photosynthesise , after they have been engulfed by an eukaryotic cell , they evolved into Chloroplasts .
However for the bacteria which used to respire , they have evolved into mitochondria.

Hope this helps :) Good Luck !
6 0
3 years ago
Read 2 more answers
In which process is lactic acid formed when there is not enough oxygen present for cellular respiration to take place?
Olenka [21]
Anaerobic respiration.
<span>Anaerobic respiration is a type of cellular respiration BUT does not use oxygen (O2). It is used when there is not enough O2 for aerobic respiration.
</span><span>It can be summarised by the equation: glucose → lactic acid (+ energy released). However, it releases less energy than aerobic repspiration due to a lack of oxygen resulting in an INCOMPLETE breakdown of glucose.
</span>
6 0
3 years ago
Gray wolves in the rocky mountains
LUCKY_DIMON [66]
What are you asking for

5 0
3 years ago
Which of the following are key features of prokaryotic cells? Select all that apply -ribosomes -cell wall. -nucleoid. -endoplasm
astraxan [27]

1st, 3rd, 5th

-ribosomes, nucleoid, plasmid

4 0
3 years ago
Read 2 more answers
Why doesnt it rain much in east ferris
aivan3 [116]

Answer:

When it is cold higher up, the water molecules in water vapor come together; the water vapor becomes liquid water, which then falls as rain When the air gets to East Ferris, there is not enough water left in it to fall as rain. East Ferris people use too much water and do not recycle.

8 0
3 years ago
Other questions:
  • Which of the following is a unit of measurement in the metric system?
    9·2 answers
  • How is a scientific theory developed?
    7·1 answer
  • Carrie's parents have brown hair. however, carrie gets genes for blond hair from both of her parents, and as a result she has bl
    8·2 answers
  • One of the most common causes of acute tubular necrosis (ATN) is:________.
    15·1 answer
  • In a population fulfilling all the assumptions of the Hardy-Weinburg equilibrium, allelic frequencies:
    6·1 answer
  • Select the reasons why organisms are classified. Check all that apply.
    14·2 answers
  • Which would have a higher solute concentration water or red blood cell
    11·1 answer
  • Name at least one thing that encouraged rapid growth and diversity in<br> organisms.
    13·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Lab Report PLEASE HELP ME
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!