1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stiv31 [10]
2 years ago
6

How long does it take a human blood cell to make a complete circuit of the human body?

Biology
1 answer:
Serjik [45]2 years ago
7 0
It takes about one minute for a blood cell to make a complete circuit of the human body.
You might be interested in
f an mRNA molecule had 300 nucleotides in the coding region of the strand, how many amino acids would be in the polypeptide that
Advocard [28]

Answer:please give me a sec I’ll help

Explanation:

8 0
2 years ago
Why do you think yeast is living?
AleksAgata [21]

Answer:

well it's not really alive it just makes bread rise

Explanation:

6 0
3 years ago
Do you think that organisms of the same order will share a stronger evolutionary relationship than organisms that share only the
ahrayia [7]

Answer:

<h3>In taxonomic, the organism is classified based on some similarities. ... But the organism with the same order should have the same phylum and class too since order is located below the phylum. That means the organism with the same order should have more similarities than the organism with the same phylum.</h3>
6 0
2 years ago
In the breakdown of taxa above there is something missing. There is a category above "kingdom" in the system above, a taxon call
CaHeK987 [17]

Hi,

The three domains of Carl Woese classification system includes bacteria, eukaryote, Eubacteria, fungi, Plantar, Animalia, Archaebacteria etc.

Hope it helps you...

Answered by Benjemin

7 0
2 years ago
Which of the following best represents the final products of the chemical reactions that take place inside the organelle labeled
stealth61 [152]
Mitochondria produce d. ATP and sugars

Hope that helps!
4 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The suns energy is classified by the
    6·2 answers
  • What feature do plants have that provide structure and form? A. Plants have an exoskeleton, like insects. B. Plants have an inte
    5·2 answers
  • Why are fungal insecticides an attractive alternative to chemical pesticides for growing food crops?
    5·1 answer
  • What problems do invasive species pose to an ecosystem?
    11·1 answer
  • Easy question, easy 100 points
    15·1 answer
  • Which of the following material has the highest electrical conductivity?
    7·1 answer
  • What are 3 parts of the nucleotide​
    5·2 answers
  • 2.1explain the body's hormonal response to dehydration​
    5·1 answer
  • Mention different stages of fertilization in plants
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!