1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blababa [14]
3 years ago
12

In a 2015 investigation, researchers from the University of Central Florida learned that baby green sea turtles move slowly (ave

raging only 0.4 miles per hour). What did they conclude from this investigation?
Biology
1 answer:
Leya [2.2K]3 years ago
7 0

Despite longstanding assumptions by marine biologists, very young sea turtles travel by swimming, not just drifting.

<u>Explanation:</u>

The movement of sea turtles will be always slower in nature. This is because they are herbivores. They feed on plants and they will be available for them in larger quantity. Hence, they move slowly because they are not in a need to run behind their food faster.

Drifting refers to the movement due to force or pressure that may be caused by wind. Swimming refers to a movement where the entire body movement is essential for moving. From the investigation by the researchers given in the example, we can conclude that despite of longstanding assumptions by marine biologists, very young sea turtles travel by swimming, not just drifting.

You might be interested in
A wide strip of trees and shrubs is cleared from one end of a forest to the other, isolating the animals on either side of the c
ddd [48]
My best guess would be C because when you split something up the mix’s of animals decreases and it would be a disturbance
6 0
4 years ago
Read 2 more answers
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
100 POINTS! CORRECT ANSWER GETS BRAINLIEST! Study the image of chromosomes in a human cell. Do the chromosomes in this image bel
postnew [5]

Answer:

Male

Explanation:

6 0
3 years ago
Read 2 more answers
Help me I’ll give 50 points helppp!
Mama L [17]

Answer:

2 Refraction, Transition/bouncing?

7. Opaque, absorbs

Explanation:

4 0
3 years ago
What does mean to say the average daytime relative humidity of. Particular city is 31 percent%
victus00 [196]

It practically means that the air in the city has less than a third of water vapor it could contain under the same circumstances.

Relative humidity is the ratio of water vapor that the air contains to the maximum amount it could carry at the same temperature.

When the humidity is high, the water vapor in the air is a variety more, and vice versa.

5 0
3 years ago
Other questions:
  • If a DNA molecule is compared to a spirtual staircase, what parts make up steps?
    8·1 answer
  • Which organelle prepares proteins for specific jobs?
    7·1 answer
  • Earth And Space!!!
    11·1 answer
  • Why does your body need more lactic acid concentration when your pulse rate goes up?
    9·1 answer
  • Which factor will increase a population's size?
    11·2 answers
  • Which of the following is a physical change? Select one: a. solid dry ice changing to a gas b. digesting a meal c. baking a cake
    9·1 answer
  • Please Help. Compare the energy input and output for nuclear fission and nuclear fusion.
    10·2 answers
  • When Surita sees a man walking around the shopping mall in December and notices that he is very robust, has a long white beard,
    12·1 answer
  • T/F Cells will make more ATP in aerobic respiration than in anaerobic respiration.
    9·1 answer
  • This term refers to the fact that the lipids and proteins can move above within the plasma membrane.
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!