1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Reptile [31]
3 years ago
14

What is the most common method large businesses use to communicate their views on environmental issues to legislators?

Biology
1 answer:
aleksklad [387]3 years ago
5 0
The most appropriate answer is d. they hire lobbyists. Lobbyists are individuals who attempt to influence government policies or legislature. Businesses pay these individuals to advocate on their behalf on policies and legislature. Lobbyists may be members of specific interest groups such as environmental protection or child care and protection. 
You might be interested in
The conversion of nitrates into atmospheric nitrogen is facilitated by microbes in a process called
Alina [70]
This process is called Denitrification. The process is undertaken by the denitrifying bacteria, whose action is converting nitrates in the soil to free atmospheric nitrogen and therefore, depleting soil fertility and reducing agricultural productivity. Examples of denitrifying bacteria are thiobacillus denitrificans, micrococcus denitrificans among others.
7 0
3 years ago
For each of the following, circle the word that does not belong belong with the rest and then in ONE complete sentence, explain
Vika [28.1K]

Answer: the words that doesn't belong include:

1.) Power

2.) Deforestation

Explanation:

1.) Coal, Oil, Solar and Natural Gas are considered to be sources of energy while POWER is not considered among the rest this is because it's energy in action and not a source of energy.

Coal, oil and natural gas are known as fossil fuels which are the most common sources of energy in industries and homes. These fossil fuels are destroyed by use, that is, they cannot be recovered. Alternative sources of energy is the solar which is gotten from the sun energy. Although not considered a very efficient energy producer, there are already discovered schemes that would provide us with an inexhaustible supply of energy which would also not cause any pollution problems.

2.) Biodegradable, Recycling and Sustainability are means by which pollution is being avoided in the environment. While DEFORESTATION is a process that can cause pollution of an environment, therefore it doesn't fit into the rest of other words.

Biodegradable materials can be broken down by microorganism. Examples include human and animal excreta. Recycling is the reprocessing of waste materials in order to be re-used. This reduces the amount of waste that are sent to incinerators. While sustainability is the maintenance of the ecosystem to remain diverse and productive over time. This could be seen in the preferred use of renewable energy over non renewable energy. But deforestation is the massive cutting down of trees which can cause soil erosion and climate changes leading to the pollution of the environment.

7 0
3 years ago
What are the differences in the dynamics of microtubules and actin filaments?
masya89 [10]

Answer:

Microtubules, like actin filaments, are dynamic structures: they can grow and shrink quickly by the addition or removal of tubulin proteins. Also similar to actin filaments, microtubules have directionality, meaning that they have two ends that are structurally different from one another. I hope this helps :)

3 0
3 years ago
Which part of a green plant shows the greatest decrease in chloroplasts in the fall of the year?
Trava [24]

Answer:

The Leaves

Explanation:

5 0
3 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Other questions:
  • What are some of the possible consequences of mutations
    10·1 answer
  • In an emergency the sympathetic nervous system helps the body by
    15·1 answer
  • Which organisms are prokaryotes?
    10·2 answers
  • The head of the sphinx once wore a headdress with a rearing cobra. what is the significance of the cobra?
    9·1 answer
  • Water can evaporate through stomata?
    15·2 answers
  • Which three human activities lead to a loss of terrestrial habitat?
    15·2 answers
  • What 3 ways do science influence society
    9·2 answers
  • A coyote has 78 chromosomes in its nucleus. What are the diploid and Haploid numbers of the coyote?
    15·1 answer
  • 6CO2 + 6H2O + LIGHT ENERGY, C6H120g is the equation for
    12·1 answer
  • The Arctic Ocean is considered part of
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!